HIPPOKRATIA

HIPPOKRATIA 

Quarterly Medical Journal 

http://www.hippokratia.gr 

ISSN 1108-4189 

Ownership: 

HIPPOKRATIO GENERAL HOSPITAL OF THESSALONIKI 

49, Konstantinoupoleos Str, 546 42 Thessaloniki, Greece 

Manager: Panteliadis P 

Editorial Board 

Editor - in - chief: Georgios V. Vergoulas 

Co - editors: Efstratiadis G and Triaridis St 

Associate Editors: Boura P, Grollios G, Kanonidou Z, Karagiannis V, Miserlis Gr, Psirropoulos D, 

Raptopoulou - Gigi M, Sampanis Ch, Vidalis A, Vogiatzis I 

Advisory Committee 

Agnanti Í (Ioannina), Altun A (Edirne), Anogianakis G (Thessaloniki), Antonakoudis Ch (Athens), 

Bamidis P (Thessaloniki), Barbullushi M (Tirana), Batistatou A (Ioannina), Boudonas G (Thessaloniki), Chaidemenos G (Thessaloniki), 

Charalobopoulos K (Ioannina), Chrysant S (Oklahoma), 

Daniilidis A (Thessaloniki), Deltas C (Nicosia), Diamandopoulos A (Patras), Dimitriou Ch (Thesssaloniki), Gerogianni N (Thessaloniki), 

Gjata M (Tirana), Goulis D (Thessaloniki), Grekas D (Thessaloniki), 

Idrizi A (Tirana), Ivanovski N (Skopje), Kiperova B (Sofia), Kontzoglou G (Thessaloniki), Koroshi A (Tirana), Kountouras I 

(Thessaloniki), Kouzmanovska D (Skopje), Kyriafinis G (Thessaloniki), Liapis H (St Louis), 

Lubomirova M (Sofia), Madias N (Boston), Makedos G (Thessaloniki), Malizos K (Larisa), 

Manes Ch (Thessaloniki), Nenov D (Varna), Oreopoulos D (Toronto), Panidis D (Thessaloniki), 

Papachristou F (Thessaloniki), Papadimas I (Thessaloniki), Papadopulos N (Munich), 

Pekovic - Perunicic G (Belgrade), Pljesa S (Belgrade), Prapas N (Thessaloniki), Proios H (New York), 

Rasic Milutinovic Z (Belgrade), Robis V (Thessaloniki), Sakadamis Ath (Thessaloniki), Spasovski G (Skopje), Stavropoulos - Giokas K 

(Athens), Stefanidis St (Thessaloniki), Stojceva Taneva O (Skopje), 

Thanoulis P (Thessaloniki), Theodorou I (Paris), Theofilopoulos A (La Jolla), Ôsara V (Thessaloniki), 

Tsitouridis I (Thessaloniki), Tzafettas J (Thessaloniki), Vougiouklis N (Thessaloniki), Vital V (Thessaloniki), 

Yonova D (Sofia), Zamboulis Ch (Thessaloniki), Zouboulis Ch (Berlin), Ziroyannis P (Athens) 

Statisticians: Kyrgidis A, Tzellos Thr 

Technical reviewers: Paschos P, Tsitsopoulos P, Vrochides D 

Technical assistant: Konstantinidis S 

Journal secretary: Veloni G 

Publication Office: LITHOGRAPHIA Ántoniadis I - Psarras Th G.P. 

19 th km, Thessaloniki - Polygyros Str, 570 01, Íea Redestos - e-mail: info@lithographia.gr, Tel. +30 2310 466776 

Annual Subscription: 30 € (Greece), 50 € (outside Greece) 

Institutions and Companies: 150 € 

Disclaimer 

The Publisher and Editors cannot be held responsible for errors or any consequencies arising 

from the use of information contained in this journal; the views and opinions expressed do not necessarily reflect those of the Publisher 

and Editors, neither does the publication of advertisements constitute 

any endorsement by the Publisher and Editors of the products advertised. 

Mailing address 

HIPPOKRATIA, Editor-in-Chief 

Hippokratio General Hospital of Thessaloniki 

49, Konstantinoupoleos Str, 546 42 Thessaloniki, Greece 

Tel. +30 2313 312674, Fax +30 2313 312674 

e-mail: hippokratia@ippokratio.gr

2 

HIPPOKRATIA 

Contents 

Volume 14 • No 1 • Junuary - March 2010 

Invited article 

The Role of Vitamin D Receptor Activation in Chronic Kidney Disease 

Cozzolino M, Malindetros P 7 

Review articles 

Systems biology in heart diseases 

Louridas GE, Kanonidis IE, Lourida KG 10 

Spondylolysis: A review and reappraisal 

Syrmou E, Tsitsopoulos PP, Marinopoulos D, Tsonidis C, Anagnostopoulos I, Tsitsopoulos PD 17 

Radiation Synovectomy: an effective alternative treatment for inflamed small joints 

Karavida N, Notopoulos A 22 

Original articles 

Platelet distribution width: a simple, practical and specific marker of activation of coagulation 

Vagdatli E, Gounari E, Lazaridou E, Katsibourlia E, Tsikopoulou F, Labrianou I 28 

Respiratory function in amyotrophic lateral sclerosis patients. The role of sleep studies 

Tsara V, Serasli E, Steiropoulos S, Tsorova A, Antoniadou M, Zisi P 33 

Sciatic nerve crush evokes a biphasic TGF-β and Decorin modulation in the rat spinal cord 

Kritis A, Kapoukranidou D, Michailidou B, Hatzisotiriou A, Albani M 37 

Case reports 

Gitelman syndrome: First report of genetically established diagnosis in Greece 

Galli-Tsinopoulou A, Patseadou M, Hatzidimitriou A, Kokka P, Emmanouilidou E, Lin SH, Tramma D 42 

Ocular complications of marfan syndrome. Report of two cases 

Mema V, Qafa N 45 

Traumatic corneal flap displacement five years after Laser in situ keratomileusis 

Grezda A, Mema V, Jaho J, Dai J 48 

Erythema nodosum associated with Salmonella enteritidis 

Mantadakis E, Arvanitidou V, Tsalkidis A, Thomaidis S, Chatzimichael A 51 

Symptomatic splenoma (hamartoma) of the spleen. A case report 

Tsitouridis I, Michaelides M, Tsitouridis K, Davidis I, Efstratiou I 54 

Guidlines of Hellenic Society of Sleep Disorders (HSSD) 

Guidelines for Diagnosing and Treating Sleep related Breathing Disorders in Adults and Children 

(Part 3: Obstructive Sleep Apnea in Children, Diagnosis and Treatment) 

Tsara V, Amfilochiou A, Papagrigorakis JM, Georgopoulos D, Liolios E, Kadiths A, Koudoumnakis E, Aulonitou E, 

Emporiadou M, Tsakanikos M, Chatzis A, Choulakis M, Chrousos G 57 

Letter 

Immunomodulation by alpha-fetoprotein in neurological disorders may involve oncogenic dilemmas 

Kountouras J, Zavos Ch, Deretzi G, Giartza-Taxidou E, Gavalas E, Chatzigeorgiou S 63

A... 

ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ Aranesp 10,15,20,30,40,50,60,80,100, 130,150,300,500 microgram ενέσιμο διάλυμα σε προγεμισμένη σύριγγα . ΠΟΙΟΤΙΚΗ ΚΑΙ ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Η κάθε προγεμισμένη σύριγγα περιέχει 10 microgram της darbepoetin alfa σε 0,4 ml (25 µg/ml), 15 microgram της darbepoetin alfa σε 0,375 ml (40 µg/ml), 20 

microgram της darbepoetin alfa σε 0,5 ml (40 µg/ml), 30 microgram της darbepoetin alfa σε 0,3 ml (100 µg/ml), 40 microgram της darbepoetin alfa σε 0,4 ml (100 µg/ml), 50 microgram της darbepoetin alfa σε 0,5 ml (100 µg/ml), 60 microgram της darbepoetin alfa σε 0,3 ml (200 µg/ml), 80 microgram της darbepoetin alfa σε 0,4 ml (200 µg/ml), 100 microgram της 

darbepoetin alfa σε 0,5 ml (200 µg/ml), 130 microgram της darbepoetin alfa σε 0,65 ml (200 µg/ml), 150 microgram της darbepoetin alfa σε 0,3 ml (500 µg/ml), 300 microgram της darbepoetin alfa σε 0,6 ml (500 µg/ml), 500 microgram της darbepoetin alfa σε 1 ml (500 µg/ml). Η darbepoetin alfa παράγεται με την εφαρμογή γονιδιακής τεχνολογίας σε κύτταρα 

ωοθήκης κινεζικού κρικητού (CHO-K1). ΦΑΡΜΑΚΟΤΕΧΝΙΚΗ ΜΟΡΦΗ Ενέσιμο διάλυμα (ενέσιμο) σε προγεμισμένη σύριγγα. ΚΛΙΝΙΚΕΣ ΠΛΗΡΟΦΟΡΙΕΣ Θεραπευτικές ενδείξεις Η θεραπεία της συμπτωματικής αναιμίας που σχετίζεται με χρόνια νεφρική ανεπάρκεια (ΧΝΑ) σε ενήλικες και παιδιατρικούς ασθενείς. Η θεραπεία της συμπτωματικής αναιμίας σε ενήλικες 

ασθενείς με καρκίνο, με μη-μυελογενείς κακοήθειες, οι οποίοι λαμβάνουν χημειοθεραπεία. Δοσολογία και τρόπος χορήγησης Η έναρξη της θεραπείας με Aranesp πρέπει να γίνεται από ιατρούς με εμπειρία στις προαναφερθείσες ενδείξεις. Το Aranesp διατίθεται έτοιμο προς χρήση σε προγεμισμένη σύριγγα. Θεραπεία της συμπτωματικής αναιμίας σε ενήλικες 

και παιδιατρικούς ασθενείς με χρόνια νεφρική ανεπάρκεια Τα συμπτώματα και τα επακόλουθα της αναιμίας μπορεί να ποικίλουν ανάλογα με την ηλικία, το φύλο και τη συνολική επιβάρυνση από την ασθένεια. Η ιατρική αξιολόγηση της κλινικής πορείας και της κατάστασης του κάθε ασθενή είναι απαραίτητη. Το Aranesp θα πρέπει να χορηγείται είτε υποδόρια 

είτε ενδοφλέβια προκειμένου η αύξηση της αιμοσφαιρίνης να μην είναι μεγαλύτερη από 12g/dl (7,5 mmol/l). Η υποδόρια χρήση προτιμάται σε ασθενείς που δεν υποβάλλονται σε αιμοκάθαρση, έτσι ώστε να αποφεύγεται η παρακέντηση των περιφερικών φλεβών. Λόγω της διαφοροποίησης μεταξύ των ασθενών, μπορεί να παρατηρηθούν σε κάποιον ασθενή 

περιστασιακές μεμονωμένες τιμές αιμοσφαιρίνης μεγαλύτερες και μικρότερες από τα επιθυμητά επίπεδα αιμοσφαιρίνης. Η διακύμανση της αιμοσφαιρίνης θα πρέπει να αντιμετωπίζεται με διαχείρηση της δόσης, έχοντας υπόψη το επιθυμητό εύρος στόχο για την αιμοσφαιρίνη από 10 g/dl (6,2 mmol/l) έως 12 g/dl (7,5 mmol/l). Επίπεδα αιμοσφαιρίνης που 

διατηρούνται πάνω από 12 g/dl (7,5 mmol/l) θα πρέπει να αποφεύγονται. Οδηγίες για την κατάλληλη προσαρμογή της δόσης όταν παρατηρούνται τιμές αιμοσφαιρίνης που ξεπερνούν τα 12 g/dl (7,5 mmol/l) περιγράφονται παρακάτω. Θα πρέπει να αποφεύγεται αύξηση της αιμοσφαιρίνης μεγαλύτερη από τα 2g/dl (1,25 mmol/l) μέσα σε διάστημα τεσσάρων 

εβδομάδων. Στην περίπτωση που αυτό συμβεί, θα πρέπει να πραγματοποιείται κατάλληλη προσαρμογή της δόσης. Η θεραπεία με Aranesp διαιρείται σε δύο στάδια – φάση διόρθωσης και συντήρησης. Οδηγίες παρέχονται ξεχωριστά για ενήλικες και παιδιατρικούς ασθενείς. Η θεραπεία παιδιατρικών ασθενών ηλικίας μικρότερης του 1 έτους δεν έχει μελετηθεί: 

Ενήλικες ασθενείς με χρόνια νεφρική ανεπάρκεια Φάση Διόρθωσης Η αρχική δόση με υποδόρια ή ενδοφλέβια χορήγηση είναι 0,45 µg/kg σωματικού βάρους, ως εφάπαξ ένεση, μία φορά την εβδομάδα. Εναλλακτικά, σε ασθενείς που δεν υποβάλλονται σε αιμοκάθαρση, μία αρχική δόση 0,75 μg/kg μπορεί να χορηγηθεί υποδόρια ως εφάπαξ ένεση μία φορά 

κάθε δύο εβδομάδες. Εάν η αύξηση της αιμοσφαιρίνης είναι ανεπαρκής (μικρότερη από 1 g/dl (0,6 mmol/l) σε τέσσερις εβδομάδες), αυξήστε τη δόση κατά 25% περίπου. Οι αυξήσεις της δόσης δεν πρέπει να γίνονται συχνότερα από μία φορά κάθε 4 εβδομάδες. Εάν η αύξηση της συγκέντρωσης της αιμοσφαιρίνης είναι μεγαλύτερη από τα 2 g/dl (1,25 mmol/l) σε 

τέσσερις εβδομάδες, μειώστε τη δόση κατά περίπου 25%. Εάν η αιμοσφαιρίνη υπερβεί τα 12 g/dl (7,5 mmol/l) θα πρέπει να εξετάζεται το ενδεχόμενο μείωσης της δόσης. Εάν η αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει να μειωθεί κατά περίπου 25%. Αν μετά από μία μείωση της δόσης η αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει 

προσωρινά να διακοπεί έως ότου η αιμοσφαιρίνη αρχίσει να μειώνεται· στο σημείο αυτό η θεραπεία θα πρέπει να αρχίζει ξανά σε επίπεδο περίπου 25% κάτω από την προηγούμενη δόση. Η μέτρηση της αιμοσφαιρίνης θα πρέπει να γίνεται κάθε μία ή δύο εβδομάδες ωσότου σταθεροποιηθεί η συγκέντρωσή της. Εφεξής, η μέτρηση της αιμοσφαιρίνης μπορεί να 

γίνεται ανά μεγαλύτερα χρονικά διαστήματα. Φάση Συντήρησης Κατά τη φάση συντήρησης, το Aranesp μπορεί να εξακολουθήσει να χορηγείται ως εφάπαξ ένεση μία φορά την εβδομάδα ή μία φορά κάθε δύο εβδομάδες. Ασθενείς που υποβάλλονται σε αιμοκάθαρση, οι οποίοι αλλάζουν συχνότητα χορήγησης της δόσης του Aranesp από μία φορά την εβδομάδα 

σε μία φορά κάθε δύο εβδομάδες, θα πρέπει αρχικά να λαμβάνουν δόση αντίστοιχη με το διπλάσιο της προηγούμενης, εβδομαδιαία χορηγούμενης δόσης. Σε ασθενείς που δεν υποβάλλονται σε αιμοκάθαρση, μετά την επίτευξη της τιμής στόχου για την αιμοσφαιρίνη με τη χορήγηση της δόσης μία φορά κάθε δύο εβδομάδες, το Aranesp μπορεί να χορηγηθεί 

υποδορίως μία φορά το μήνα, χρησιμοποιώντας ως αρχική δόση τη διπλάσια της προηγούμενης, χορηγούμενης μία φορά κάθε δύο εβδομάδες, δόσης. Η δοσολογία θα πρέπει να τιτλοποιείται κατάλληλα, προκειμένου να διατηρηθεί η αιμοσφαιρίνη – στόχος. Εάν απαιτείται ρύθμιση της δόσης για τη διατήρηση της αιμοσφαιρίνης στο επιθυμητό επίπεδο, συνιστάται 

η δόση να ρυθμίζεται κατά 25% περίπου. Αν η αύξηση της αιμοσφαιρίνης είναι μεγαλύτερη από 2g/dl (1,25mmol/l) σε διάστημα τεσσάρων εβδομάδων, μειώστε τη δόση κατά περίπου 25%, ανάλογα με το ρυθμό αύξησης. Εάν η συγκέντρωση της αιμοσφαιρίνης υπερβεί τα 12 g/dl (7,5 mmol/l), θα πρέπει να εξετάζεται το ενδεχόμενο μείωσης της δόσης. Εάν η 

αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει να μειωθεί κατά περίπου 25%. Αν μετά από μία μείωση της δόσης η αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει προσωρινά να διακοπεί έως ότου η αιμοσφαιρίνη αρχίσει να μειώνεται· στο σημείο αυτό η θεραπεία θα πρέπει να αρχίζει ξανά σε επίπεδο περίπου 25% κάτω από την προηγούμενη 

δόση. Οι ασθενείς θα πρέπει να παρακολουθούνται προσεκτικά ώστε να διασφαλίζεται ότι χρησιμοποιείται η χαμηλότερη εγκεκριμένη δόση του Aranesp προκειμένου τα συμπτώματα της αναιμίας να ελέγχονται επαρκώς. Μετά από οποιαδήποτε ρύθμιση της δόσης ή του προγράμματος χορήγησης των δόσεων, η αιμοσφαιρίνη θα πρέπει να παρακολουθείται κάθε 

μία ή δύο εβδομάδες. Οι μεταβολές της δόσης στη φάση συντήρησης της θεραπείας δεν θα πρέπει να γίνονται συχνότερα από κάθε δύο εβδομάδες. Όταν αλλάζει η οδός χορήγησης, θα πρέπει να χρησιμοποιείται η ίδια δόση και να παρακολουθείται η αιμοσφαιρίνη κάθε μία ή δύο εβδομάδες, έτσι ώστε να γίνονται οι κατάλληλες ρυθμίσεις της δόσης για να 

διατηρείται η αιμοσφαιρίνη στο επιθυμητό επίπεδο. Κλινικές μελέτες έχουν δείξει ότι ενήλικες ασθενείς που λαμβάνουν r-HuEPO μία, δύο ή τρεις φορές εβδομαδιαίως, είναι δυνατό να μεταταχθούν σε θεραπεία με Aranesp με συχνότητα μία φορά εβδομαδιαίως ή μία φορά κάθε δύο εβδομάδες. Η αρχική εβδομαδιαία δόση του Aranesp (µg/εβδομάδα) μπορεί να 

προσδιοριστεί με διαίρεση της ολικής εβδομαδιαίας δόσης του r-HuEPO (IU/εβδομάδα) με το 200. Η αρχική δόση του Aranesp για χορήγηση μία φορά κάθε δύο εβδομάδες (µg/δεύτερη εβδομάδα) μπορεί να προσδιοριστεί με διαίρεση του συνολικού αθροίσματος των δόσεων του r-HuEPO που χορηγούνται σε διάστημα δύο εβδομάδων με το 200. Λόγω της 

ποικιλότητας μεταξύ των ασθενών, ο προσδιορισμός της βέλτιστης θεραπευτικής δόσης για τον κάθε ασθενή αναμένεται να επιτευχθεί με τιτλοποίηση. Όταν το Aranesp υποκαθιστά το r-HuEPO, η αιμοσφαιρίνη θα πρέπει να παρακολουθείται κάθε μία ή δύο εβδομάδες και θα πρέπει να χρησιμοποιείται η ίδια οδός χορήγησης. Παιδιατρικοί ασθενείς με χρόνια 

νεφρική ανεπάρκεια Φάση Διόρθωσης Για ασθενείς ηλικίας ≥11 ετών, η αρχική δόση με υποδόρια ή ενδοφλέβια χορήγηση είναι 0,45 µg/kg σωματικού βάρους, ως εφάπαξ ένεση, μία φορά την εβδομάδα. Εναλλακτικά, σε ασθενείς που δεν υποβάλλονται σε αιμοκάθαρση, μία αρχική δόση 0,75 μg/kg μπορεί να χορηγηθεί υποδόρια ως εφάπαξ ένεση μία φορά 

κάθε δύο εβδομάδες. Εάν η αύξηση της αιμοσφαιρίνης είναι ανεπαρκής (μικρότερη από 1 g/dl (0,6 mmol/l) σε τέσσερις εβδομάδες), αυξήστε τη δόση κατά 25% περίπου. Οι αυξήσεις της δόσης δεν πρέπει να γίνονται συχνότερα από μία φορά κάθε 4 εβδομάδες. Εάν η αύξηση της συγκέντρωσης της αιμοσφαιρίνης είναι μεγαλύτερη από τα 2 g/dl (1,25 mmol/l) σε 

τέσσερις εβδομάδες, μειώστε τη δόση περίπου 25%, ανάλογα με το ρυθμό της αύξησης. Εάν η αιμοσφαιρίνη υπερβεί τα 12 g/dl (7,5 mmol/l), θα πρέπει να εξετάζεται το ενδεχόμενο μείωσης της δόσης. Εάν η αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει να μειωθεί κατά περίπου 25%. Αν μετά από μία μείωση της δόσης η αιμοσφαιρίνη εξακολουθεί 

να αυξάνεται, η δόση θα πρέπει προσωρινά να διακοπεί έως ότου η αιμοσφαιρίνη αρχίσει να μειώνεται· στο σημείο αυτό η θεραπεία θα πρέπει να αρχίζει ξανά σε επίπεδο περίπου 25% κάτω από την προηγούμενη δόση. Η μέτρηση της συγκέντρωσης της αιμοσφαιρίνης θα πρέπει να γίνεται κάθε μία ή δύο εβδομάδες ωσότου σταθεροποιηθεί η συγκέντρωσή της. 

Εφεξής, η μέτρηση της αιμοσφαιρίνης μπορεί να γίνεται ανά μεγαλύτερα χρονικά διαστήματα. Δεν υπάρχουν οδηγιές σχετικά με τη διόρθωση της αιμοσφαιρίνης για παιδιατρικούς ασθενείς ηλικίας 1 έως 10 ετών. Φάση Συντήρησης Για παιδιατρικούς ασθενείς ηλικίας ≥11 ετών, κατά τη φάση συντήρησης, το Aranesp μπορεί να εξακολουθήσει να χορηγείται ως 

εφάπαξ ένεση μία φορά την εβδομάδα ή μία φορά κάθε δύο εβδομάδες. Ασθενείς που υποβάλλονται σε αιμοκάθαρση, οι οποίοι αλλάζουν συχνότητα χορήγησης της δόσης του Aranesp από μία φορά την εβδομάδα σε μία φορά κάθε δύο εβδομάδες, θα πρέπει αρχικά να λαμβάνουν δόση αντίστοιχη με το διπλάσιο της προηγούμενης, εβδομαδιαία χορηγούμενης 

δόσης. Σε ασθενείς που δεν υποβάλλονται σε αιμοκάθαρση, μετά την επίτευξη της τιμής στόχου για την αιμοσφαιρίνη με τη χορήγηση της δόσης μία φορά κάθε δύο εβδομάδες, το Aranesp μπορεί να χορηγηθεί υποδορίως μία φορά το μήνα, χρησιμοποιώντας ως αρχική δόση τη διπλάσια της προηγούμενης, χορηγούμενης μία φορά κάθε δύο εβδομάδες, δόσης. 

Για παιδιατρικούς ασθενείς ηλικίας 1-18 ετών, κλινικά δεδομένα από παιδιατρικούς ασθενείς κατέδειξαν ότι ασθενείς που λαμβάνουν r-HuEPO δύο ή τρεις φορές εβδομαδιαίως είναι δυνατό να μεταταχθούν σε θεραπεία με Aranesp με συχνότητα μία φορά εβδομαδιαίως και αυτοί που λαμβάνουν r-HuEPO μία φορά εβδομαδιαίως είναι δυνατό να μεταταχθούν σε 

θεραπεία με Aranesp με συχνότητα μία φορά κάθε δύο εβδομάδες. Η αρχική εβδομαδιαία ή μία φορά κάθε δύο εβδομάδες παιδιατρική δόση του Aranesp (µg/εβδομάδα) μπορεί να προσδιοριστεί με διαίρεση της ολικής εβδομαδιαίας δόσης του r-HuEPO (IU/εβδομάδα) με το 240. Λόγω της ποικιλότητας μεταξύ των ασθενών, ο προσδιορισμός της βέλτιστης 

θεραπευτικής δόσης για τον κάθε ασθενή αναμένεται να επιτευχθεί με τιτλοποίηση. Όταν το Aranesp υποκαθιστά το r-HuEPO, η αιμοσφαιρίνη θα πρέπει να παρακολουθείται κάθε μία ή δύο εβδομάδες και θα πρέπει να χρησιμοποιείται η ίδια οδός χορήγησης. Η δοσολογία θα πρέπει να τιτλοποιείται κατάλληλα, προκειμένου να διατηρηθεί η αιμοσφαιρίνη – στόχος. 

Εάν απαιτείται ρύθμιση της δόσης για τη διατήρηση της αιμοσφαιρίνης στο επιθυμητό επίπεδο, συνιστάται η δόση να ρυθμίζεται κατά 25% περίπου. Αν η αύξηση της αιμοσφαιρίνης είναι μεγαλύτερη από 2g/dl (1,25mmol/l) σε διάστημα τεσσάρων εβδομάδων, μειώστε τη δόση κατά περίπου 25%, ανάλογα με το ρυθμό αύξησης. Εάν η συγκέντρωση της 

αιμοσφαιρίνης υπερβεί τα 12 g/dl (7,5 mmol/l), θα πρέπει να εξετάζεται το ενδεχόμενο μείωσης της δόσης. Εάν η αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει να μειωθεί κατά περίπου 25%. Αν μετά από μία μείωση της δόσης η αιμοσφαιρίνη εξακολουθεί να αυξάνεται, η δόση θα πρέπει προσωρινά να διακοπεί έως ότου η αιμοσφαιρίνη αρχίσει να 

μειώνεται· στο σημείο αυτό η θεραπεία θα πρέπει να αρχίζει ξανά σε επίπεδο περίπου 25% κάτω από την προηγούμενη δόση. Οι ασθενείς θα πρέπει να παρακολουθούνται προσεκτικά ώστε να διασφαλίζεται ότι χρησιμοποιείται η χαμηλότερη εγκεκριμένη δόση του Aranesp προκειμένου τα συμπτώματα της αναιμίας να ελέγχονται επαρκώς. Μετά από οποιαδήποτε 

ρύθμιση της δόσης ή του προγράμματος χορήγησης των δόσεων, η συγκέντρωση της αιμοσφαιρίνης θα πρέπει να παρακολουθείται κάθε μία ή δύο εβδομάδες. Οι μεταβολές της δόσης στη φάση συντήρησης της θεραπείας δεν θα πρέπει να γίνονται συχνότερα από κάθε δύο εβδομάδες. Όταν αλλάζει η οδός χορήγησης, θα πρέπει να χρησιμοποιείται η ίδια δόση 

και να παρακολουθείται η αιμοσφαιρίνη κάθε μία ή δύο εβδομάδες, έτσι ώστε να γίνονται οι κατάλληλες ρυθμίσεις της δόσης για να διατηρείται η αιμοσφαιρίνη στο επιθυμητό επίπεδο. Αντενδείξεις Υπερευαισθησία στην darbepoetin alfa, το r-HuEPO ή σε οποιοδήποτε από τα έκδοχα. Ανεπαρκώς ελεγχόμενη υπέρταση. Ειδικές προειδοποιήσεις και προφυλάξεις 

κατά τη χρήση Γενικά Η πίεση του αίματος θα πρέπει να παρακολουθείται σε όλους τους ασθενείς, ιδιαίτερα κατά την έναρξη της θεραπείας με Aranesp. Εάν είναι δύσκολο να ελεγχθεί η πίεση του αίματος με την εφαρμογή των κατάλληλων μέτρων, η αιμοσφαιρίνη θα πρέπει να ελαττώνεται με τη μείωση ή συγκράτηση της δόσης του Aranesp Προκειμένου να 

διασφαλιστεί η αποτελεσματική ερυθροποίηση, πριν και κατά τη διάρκεια της θεραπείας, θα πρέπει να αξιολογείται η κατάσταση του σιδήρου για όλους τους ασθενείς – συμπληρωματική δε θεραπεία με σίδηρο μπορεί να είναι απαραίτητη. Η μη απόκριση στη θεραπεία με Aranesp θα πρέπει να αποτελέσει αίτιο διερεύνησης των αιτιολογικών παραγόντων. Οι 

ανεπάρκειες του σιδήρου, του φολικού οξέος ή της Βιταμίνης B12 μειώνουν την αποτελεσματικότητα των παραγόντων διέγερσης της ερυθροποίησης και επομένως θα πρέπει να αποκαθίστανται. Οι ενδιάμεσες λοιμώξεις, τα φλεγμονώδη ή τραυματικά επεισόδια, η λανθάνουσα απώλεια αίματος, η αιμόλυση, η σοβαρή τοξίκωση αργιλίου, οι υποκείμενες 

αιματολογικές ασθένειες ή η ίνωση του μυελού των οστών ενδέχεται επίσης να μειώσουν την ερυθροποιητική απόκριση. Ο αριθμός των δικτυοερυθροκυττάρων θα πρέπει να θεωρείται μέρος της αξιολόγησης. Στην περίπτωση που οι τυπικές αιτίες μη ανταπόκρισης έχουν αποκλειστεί, και ο ασθενής εμφανίζει δικτυοερυθροκυτταροπενία, θα πρέπει να εξετάζεται 

η περίπτωση ελέγχου του μυελού των οστών. Αν η εικόνα του μυελού των οστών είναι συμβατή με αμιγή ερυθροκυτταρική απλασία (PRCA), θα πρέπει να διενεργείται έλεγχος για αντι-ερυθροποιητικά αντισώματα. Αμιγής ερυθροκυτταρική απλασία λόγω ανάπτυξης εξουδετερωτικών αντι-ερυθροποιητικών αντισωμάτων έχει αναφερθεί να σχετίζεται με τις 

ανασυνδυασμένες ερυθροποιητικές πρωτεΐνες, συμπεριλαμβανομένης της darbepoetin alfa. Αυτό έχει κυρίως αναφερθεί σε ασθενείς με Χρόνια Νεφρική Ανεπάρκεια (ΧΝΑ), οι οποίοι λάμβαναν τη θεραπεία υποδορίως. Έχει καταδειχθεί, ότι τα αντισώματα αυτά χαρακτηρίζονται από διασταυρούμενη αντίδραση με όλες τις ερυθροποιητικές πρωτεΐνες και ασθενείς 

με υποψία ή επιβεβαιωμένη παρουσία εξουδετερωτικών αντισωμάτων σε ερυθροποιητίνη , δεν πρέπει να μετατάσσονται σε darbepoetin alfa Η ενεργή ηπατοπάθεια ήταν κριτήριο αποκλεισμού σε όλες τις μελέτες του Aranesp και, συνεπώς, δεν υπάρχουν διαθέσιμα δεδομένα από ασθενείς με βλάβη της ηπατικής λειτουργίας. Επειδή το ήπαρ θεωρείται ότι αποτελεί 

την κύρια οδό αποβολής του Aranesp και του r-HuEPO, το Aranesp θα πρέπει να χρησιμοποιείται με προσοχή σε ασθενείς με ηπατοπάθεια. Το Aranesp θα πρέπει επίσης να χρησιμοποιείται με προσοχή σε εκείνους τους ασθενείς που πάσχουν από δρεπανοκυτταρική αναιμία ή επιληψία. Η εσφαλμένη χρήση του Aranesp από υγιή άτομα μπορεί να οδηγήσει σε 

υπερβολική αύξηση του όγκου των έμμορφων συστατικών του αίματος, κατάσταση που ίσως σχετίζεται με απειλητικές για τη ζωή επιπλοκές από το καρδιαγγειακό σύστημα. Το κάλυμμα της βελόνας της προγεμισμένης σύριγγας περιέχει ξηρό φυσικό ελαστικό (ένα παράγωγο του λάτεξ), το οποίο μπορεί να προκαλέσει αλλεργικές αντιδράσεις. Σε ασθενείς με 

χρόνια νεφρική ανεπάρκεια, η συγκέντρωση της αιμοσφαιρίνης συντήρησης δεν θα πρέπει να υπερβαίνει το ανώτερο όριο της συγκέντρωσης της αιμοσφαιρίνης-στόχου που συστήνεται στην παράγραφο 4.2. Σε κλινικές μελέτες, παρατηρήθηκε αυξημένος κίνδυνος θανάτου, σοβαρών καρδιαγγειακών επεισοδίων και θρόμβωσης αγγειακής προσπέλασης όταν οι 

παράγοντες διέγερσης της ερυθροποίησης (ESAs) χορηγήθηκαν για την επίτευξη αιμοσφαιρίνης υψηλότερης των 12 g/dl (7,5 mmol/l). Ελεγχόμενες κλινικές μελέτες δεν έδειξαν σημαντικά οφέλη αποδειδόμενα στη χορήγηση ερυθροποιητινών όταν η συγκέντρωση της αιμοσφαιρίνης αυξάνεται πάνω από το επίπεδο που απαιτείται για τον έλεγχο των συμπτωμάτων 

της αναιμίας και την αποφυγή των μεταγγίσεων αίματος. Το Aranesp θα πρέπει να χρησιμοποιείται με προσοχή σε ασθενείς με επιληψία. Έχουν αναφερθεί σπασμοί σε ασθενείς που λαμβάνουν Aranesp. Ασθενείς με χρόνια νεφρική ανεπάρκεια Για όλους τους ασθενείς με τιμές φερριτίνης ορού χαμηλότερες από 100 μg/l ή των οποίων ο κορεσμός της τρανσφερίνης 

είναι χαμηλότερος από 20%, συνιστάται η θεραπεία με συμπληρώματα σιδήρου. Στους ασθενείς που πάσχουν από χρόνια νεφρική ανεπάρκεια και έχουν κλινικές ενδείξεις ισχαιμικής καρδιοπάθειας ή συμφορητικής καρδιακής ανεπάρκειας, η τιμή – στόχος αιμοσφαιρίνης θα πρέπει να προσδιορίζεται μεμονωμένα. Για τους ασθενείς αυτούς στόχο θα πρέπει να 

αποτελεί η επίτευξη του ανώτατου ορίου της τάξης των 12 g/dl (7,5 mmol/l), εκτός εάν η ύπαρξη σοβαρών συμπτωμάτων (π.χ. στηθάγχη) υποδεικνύει διαφορετική πρακτική. Τα επίπεδα του καλίου στον ορό του αίματος θα πρέπει να παρακολουθούνται τακτικά κατά τη θεραπεία με Aranesp. Έχει αναφερθεί αύξηση του επιπέδου του καλίου σε κάποιους ασθενείς 

που λαμβάνουν Aranesp, χωρίς να έχει διαπιστωθεί αιτιώδης σχέση. Εάν παρατηρηθεί αυξημένο ή αυξανόμενο επίπεδο καλίου, θα πρέπει να εξεταστεί το ενδεχόμενο διακοπής της χορήγησης Aranesp μέχρι να αποκατασταθεί το επίπεδο του καλίου. Αλληλεπιδράσεις με άλλα φαρμακευτικά προϊόντα και άλλες μορφές αλληλεπίδρασης Τα μέχρι στιγμής 

κλινικά αποτελέσματα δεν υποδεικνύουν οποιαδήποτε αλληλεπίδραση του Aranesp με άλλες ουσίες. Ωστόσο, υπάρχει το ενδεχόμενο αλληλεπίδρασης με φάρμακα τα οποία δεσμεύονται ισχυρά με τα ερυθρά αιμοσφαίρια , π.χ .cyclosporin, tacrolimus. Εάν η darbepoetin alfa χορηγηθεί παράλληλα με κάποιο από αυτά τα φάρμακα, θα πρέπει να παρακολουθούνται 

τα επίπεδα αυτών των φαρμάκων στο αίμα και να ρυθμίζεται η δοσολογία, καθώς αυξάνεται η αιμοσφαρίνη. Κύηση και γαλουχία Δεν διατίθενται κλινικά δεδομένα σχετικά με έκθεση κατά την εγκυμοσύνη στo Aranesp. Μελέτες σε ζώα δεν κατέδειξαν άμεσες επικίνδυνες επιπτώσεις στην εγκυμοσύνη, στην ανάπτυξη του εμβρύου, στον τοκετό ή στη μεταγεννητική 

ανάπτυξη. Η χορήγηση σε έγκυες γυναίκες πρέπει να πραγματοποιείται με ιδιαίτερη προσοχή. Καθώς δεν υπάρχει κλινική εμπειρία με θηλάζουσες γυναίκες, το Aranesp δεν θα πρέπει να χορηγείται σε γυναίκες που θηλάζουν. Όταν η θεραπεία με Aranesp ενδείκνυται απόλυτα, οι γυναίκες πρέπει να σταματήσουν το θηλασμό. Επιδράσεις στην ικανότητα οδήγησης 

και χειρισμού μηχανών Δεν έχει παρατηρηθεί καμία επίδραση του Aranesp στην ικανότητα οδήγησης και χειρισμού μηχανών. Ανεπιθύμητες ενέργειες Γενικά Έχουν γίνει αναφορές σοβαρών αλλεργικών αντιδράσεων που σχετίζονται με darbepoetin alfa, συμπεριλαμβανομένων αναφυλακτικής αντίδρασης, αγγειοοιδήματος, δύσπνοιας, δερματικού εξανθήματος 

και κνίδωσης. Εμπειρία από κλινικές μελέτες Ασθενείς με χρόνια νεφρική ανεπάρκεια Τα δεδομένα από ελεγχόμενες μελέτες που παρουσιάστηκαν περιλάμβαναν 1357 ασθενείς, 766 που έλαβαν Aranesp και 591 ασθενείς που έλαβαν r-HuEPO. Στην ομάδα του Aranesp, το 83% υποβαλλόταν σε αιμοκάθαρση και το 17% δεν υποβαλλόταν σε αιμοκάθαρση. Στις 

μελέτες όπου χορηγήθηκε το Aranesp με υποδόρια ένεση αναφέρθηκε άλγος της θέσης ένεσης, το οποίο αποδόθηκε στη θεραπεία. Αυτό παρουσιάστηκε συχνότερα απ' ότι με το r-HuEPO. Η δυσφορία στη θέση της ένεσης είχε κατά κανόνα ήπια και παροδική φύση και παρουσιάστηκε κυρίως μετά την πρώτη ένεση. Η συχνότητα εμφάνισης ανεπιθύμητων ενεργειών 

οι οποίες θεωρήθηκαν ότι σχετίζονται με τη θεραπεία με Aranesp κατά τις ελεγχόμενες κλινικές μελέτες είναι: Κατηγορία οργάνου συστήματος σύμφωνα με τη συνθήκη MedDRA Συχνότητα εμφάνισης σε άτομα Ανεπιθύμητη ενέργεια φαρμάκου Καρδιακές διαταραχές Πολύ συχνές (≥1/10) Υπέρταση Διαταραχές του δέρματος και του υποδόριου ιστού 

Συχνές (≥1/100 έως

Α-00558 

ΠΡΟΣΑΡΜΟΓΗ: 

ΠΕΡΙΛΗΨΗ ΤΩΝ ΧΑΡΑΚΤΗΡΙΣΤΙΚΩΝ ΤΟΥ ΠΡΟΪΟΝΤΟΣ 1. ΟΝΟΜΑΣΙΑ ΤΟΥ ΦΑΡΜΑΚΕΥΤΙΚΟΥ ΠΡΟΪΟΝΤΟΣ •Zemplar 1 µικρογραµµάριο καψάκια, µαλακά •Zemplar 2 µικρογραµµάρια καψάκια, µαλακά•Zemplar 4 µικρογραµµάρια καψάκια, µαλακά 2. ΠΟΙΟΤΙΚΗ ΚΑΙ 

ΠΟΣΟΤΙΚΗ ΣΥΝΘΕΣΗ Κάθε καψάκιο, µαλακό περιέχει: Zemplar 1 µικρογραµµάριο: Παρικαλσιτόλη: 1 µικρογραµµάριο. Έκδοχα (Αιθανόλη): 0,71 mg. Zemplar 2 µικρογραµµάρια: Παρικαλσιτόλη: 2 µικρογραµµάρια. Έκδοχα (Αιθανόλη):1,42 mg. Zemplar 4 µικρογραµµάρια: 

Παρικαλσιτόλη: 4 µικρογραµµάρια.Έκδοχα (Αιθανόλη):1,42 mg. Για τον πλήρη κατάλογο των εκδόχων, βλ. παράγραφο 6.1. 3. ΦΑΡΜΑΚΟΤΕΧΝΙΚΗ ΜΟΡΦΗ Καψάκιο, µαλακό Καψάκιο 1 µικρογραµµαρίου: οβάλ, γκρι χρώµατος µαλακό καψάκιο προτυπωµένο µε το λογότυπο 

« » και «ZA». Καψάκιο 2 µικρογραµµαρίων: οβάλ, πορτοκαλί-καφέ χρώµατος µαλακό καψάκιο προτυπωµένο µε το λογότυπο « » και «ZF». Καψάκιο 4 µικρογραµµαρίων: οβάλ, χρυσού χρώµατος µαλακό καψάκιο προτυπωµένο µε το λογότυπο « » και «ZΚ». 4. ΚΛΙΝΙΚΕΣ 

ΠΛΗΡΟΦΟΡΙΕΣ 4.1 Θεραπευτικές ενδείξεις Το Zemplar ενδείκνυται για την πρόληψη και τη θεραπεία του δευτεροπαθούς υπερπαραθυρεοειδισµού σε ασθενείς µε χρόνια νεφρική ανεπάρκεια (χρόνια νεφρική νόσος Σταδίου 3 και 4) και ασθενείς µε χρόνια νεφρική 

ανεπάρκεια υπό αιµοκάθαρση ή περιτοναϊκή κάθαρση (χρόνια νεφρική νόσος Σταδίου 5). 4.3 Αντενδείξεις Η παρικαλσιτόλη δεν πρέπει να χορηγείται σε ασθενείς µε ένδειξη τοξικότητας στη βιταµίνη D, υπερασβεστιαιµία ή υπερευαισθησία στην παρικαλσιτόλη ή σε 

κάποιο από τα έκδοχα αυτού του φαρµακευτικού προϊόντος. 4.4 Ειδικές προειδοποιήσεις και προφυλάξεις κατά τη χρήση Η υπερβολική καταστολή της παραθορµόνης µπορεί να επιφέρει αυξήσεις στα επίπεδα ασβεστίου του ορού και µπορεί να οδηγήσει σε χαµηλό 

ρυθµό αποκατάστασης (low-turnover) της νόσου των οστών. Απαιτείται παρακολούθηση των ασθενών και εξατοµικευµένη ρύθµιση της δόσης προκειµένου να επιτευχθούν κατάλληλα φυσιολογικά τελικά επίπεδα. Εάν αναπτυχθεί κλινικά σηµαντική υπερασβεστιαιµία και 

ο ασθενής λαµβάνει κάποιο δεσµευτικό φωσφόρου που περιέχει ασβέστιο, η δόση του τελευταίου πρέπει να µειώνεται ή να διακόπτεται. H τοξικότητα της δακτυλίτιδας ενισχύεται από υπερασβεστιαιµία οποιασδήποτε αιτιολογίας, γι’ αυτό πρέπει να επιδεικνύεται 

προσοχή όταν η δακτυλίτιδα συνταγογραφείται ταυτόχρονα µε παρικαλσιτόλη (βλ. Παράγραφο 4.5). Πρέπει να επιδεικνύεται προσοχή κατά τη συγχορήγηση παρικαλσιτόλης µε κετοκοναζόλη (βλ. Παράγραφο 4.5). Προειδοποιήσεις για τα έκδοχα: Αυτό το φαρµακευτικό 

προϊόν περιέχει µικρές ποσότητες αιθανόλης (αλκοόλη), κάτω των 100 mg ανά καψάκιο του 1 mcg, των 2 mcg και των 4 mcg, η οποία µπορεί να είναι επιβλαβής σε ασθενείς που πάσχουν από αλκοολισµό (ανατρέξτε στις παραγράφους 2 και 4.2). Πρέπει να λαµβάνεται 

υπόψη σε έγκυες ή θηλάζουσες γυναίκες, παιδιά και οµάδες υψηλού κινδύνου όπως ασθενείς µε ηπατική νόσο ή επιληψία. 4.8 Ανεπιθύµητες ενέργειες Χρόνια Νεφρική Νόσος, Στάδια 3 και 4 Η ασφάλεια των καψακίων παρικαλσιτόλης έχει αξιολογηθεί σε τρεις 

24-εβδοµάδων, διπλές-τυφλές, ελεγχόµενες µε εικονικό φάρµακο, πολυκεντρικές κλινικές δοκιµές οι οποίες περιλάµβαναν 220 ασθενείς µε Χρόνια Νεφρική Νόσο, Σταδίου 3 και 4. Δεν υπήρξαν στατιστικά σηµαντικές διαφορές µεταξύ των ασθενών υπό θεραπεία µε 

παρικαλσιτόλη και αυτών υπό θεραπεία µε εικονικό φάρµακο ως προς τη συχνότητα εµφάνισης υπερασβεστιαιµίας: Zemplar (2/106, 2 %) έναντι εικονικού φαρµάκου (0/111, 0 %) ή αυξηµένων επιπέδων γινοµένου ασβεστίου – φωσφόρου: Zemplar (13/106, 12%) έναντι 

εικονικού φαρµάκου (7/111, 6%). Η συχνότερη ανεπιθύµητη ενέργεια που έχει αναφερθεί σε ασθενείς υπό θεραπεία µε παρικαλσιτόλη ήταν εξάνθηµα, το οποίο παρατηρείται στο 2% των ασθενών. Όλες οι ανεπιθύµητες ενέργειες τουλάχιστον σχετιζόµενες µε την 

παρικαλσιτόλη, τόσο κλινικές όσο και εργαστηριακές, παρατίθενται στον Πίνακα 3 µε την Kατηγορία Oργάνου Συστήµατος σύµφωνα µε το MedDRA, τον Προτιµώµενο Όρο και τη συχνότητα εµφάνισης. Χρησιµοποιούνται οι ακόλουθες κατηγορίες συχνότητας εµφάνισης: 

πολύ συχνές (≥1/10) • συχνές (≥1/100 έως

HIPPOKRATIA 2010, 14, 1 5

HIPPOKRATIA 2010, 14, 1: 7-9 

HIPPOKRATIA PASCHOS 2010, KA 14, 1 7 

The Role of Vitamin D Receptor Activation in Chronic Kidney Disease 

Cozzolino M 1 , Malindretos P 2 

1 Renal Division, S. Paolo Hospital, University of Milan, Milan, Italy 

2 Renal Department, Achillopouleio Hospital, Volos, Greece 

Chronic Kidney Disease – Mineral and Bone Disorder 

(CKD-MBD) begins early in the course of kidney disease 

and is under-diagnosed. Decreased vitamin D receptor 

(VDR) activation is a major pathophysiologic factor in the 

development of secondary hyperparathyroidism (SHPT) 

and contributes to CKD morbidity and mortality. In contrast, 

VDR inactivation influences bone and cardiovascular 

disease (CVD) progression and mortality. Some data suggest 

that treatment choices influence patient survival. These 

data underline the need for early assessment and clear management 

strategies. It is important to identify patients at increased 

risk for a poor prognosis and to better understand 

whether early treatment will benefit these patients. 

Observational data indicate that there is a close inter-relationship 

between progressive renal dysfunction 

in CKD patients, CVD, and mortality 1 . Causes of mortality 

in patients with even moderate kidney dysfunction 

(measured by estimated glomerular filtration rates, 

[GFR]) are commonly associated with cardiovascular-related 

events 1 . Data from a 5-year prospective longitudinal 

study involving more than 27,000 patients in the United 

States have shown that CKD patients are more likely to 

die than develop end stage renal disease (ESRD), and that 

congestive heart failure (CHF) and coronary artery disease 

were both more prevalent than haemodialysis in this 

patient population 2 . 

CKD is characterized by progressive kidney dysfunction, 

manifest at later stages through notably diminished 

GFR, endocrine dysfunction, extra-skeletal calcification, 

and mineral metabolism disorders 3 . Reduced vitamin D 

INVITED ARTICLE 

Abstract 

The death rate from cardiovascular disease for dialysis patients is much higher than the general population, regardless 

of age. Observational data indicate that there is a close inter-relationship between progressive renal dysfunction in 

patients with chronic kidney disease cardiovascular disease and mortality. 

Continuously evidence indicates that deficiencies in vitamin D receptor activation represents one of key players in 

adversely affecting cardiovascular health, as well as inducing to secondary hyperparathyroidism in chromic kidney disease 

patients. Vitamin D receptors are widely expressed throughout the body and modulations of vitamin D levels results 

in correlative regulatory effects on mineral metabolism homeostasis, cardiovascular disease, and vascular calcification. 

The management of SHPT has developed enormously in recent years and different drug classes are available to treat this 

disease. Potentially, selective VDR activators not only reduce serum parathyroid hormone levels minimizing the risk of 

hypercalcemia and hyperphosphatemia, but also may improve patient health, reducing the risk of cardiovascular disease. 

Hippokratia 2010; 14 (1): 7-9 

Key words: vitamin D, haemodialysis, cardiovascular disease 

Corresponding author: Cozzolino Μario, Renal Division, S. Paolo Hospital, University of Milan, Via A. di Rudinì, 8-20142, Milan, Italy, Tel: 

+02-81844381, Fax: +02-89129989, e-mail: mariocozzolino@hotmail.com 

receptor (VDR) activation may occur early in the course 

of CKD as a consequence of vitamin D deficiency and 

CKD-associated mineral bone disease (MBD), effects 

frequently appearing before a significant rise in parathyroid 

hormone (PTH) levels 4 . VDR activators or agonists 

effectively lower elevated PTH levels and provide 

improved patient survival compared with untreated patients 

5 . VDR activators initiate signaling through ligand 

binding to the ubiquitously-present VDR, followed by 

activation of downstream endocrine, paracrine, and/or 

autocrine loops to maintain homeostasis in the kidney, 

bone, immune, and cardiovascular systems 6 . The continued 

development of newer VDR activators has led to 

further improvement in VDR tissue selectivity and safety, 

showing equivalent or better PTH-reducing effects, and 

expanded clinical impact on cardiovascular endpoints 

beyond reducing PTH levels while minimizing effects on 

calcium and phosphorus absorption in the intestine 7-9 . 

VDR Activation in CKD and Cardiovascular Disease 

Epidemiology 

It has been shown that in the presence of altered kidney 

function, 50% of the patients with vitamin D insufficiency 

and thus decreased VDR activation will have 

normal PTH levels 4 . This observation is more evident for 

those with lower levels of GFR. Additionally it is well 

known that the rate of cardiovascular events, as well as 

mortality rate, increase as GFR declines 1 . In a recent 

study, an increased relative risk was observed in hemodialysis 

dependent patients with low levels of calcitriol

(1,25(OH) vit. D), which was ameliorated by the treatment 

with VDR activators 10 . Similarly, in a well designed 

retrospective study which included more than 40,000 hemodialysis 

patients, the protective action of VDR activators 

was revealed 11 . These patients showed approximately 

20% better total and cardiovascular survival over those 

who did not follow VDR activator treatment 11 . Another 

impressive finding of this study was the sustained advantage 

of VDR activation independent of age, gender, race, 

calcium, phosphorus and PTH levels. Following the same 

pattern, other ethnic observational studies have shown a 

clear survival advantage in favor of VDR activators in 

hemodialysis patients with elevated PTH levels 12 . 

On the other hand, other statistical approaches of the 

same data from the DOPPS study have shown no benefit 

for those under VDR activators treatment 13 . According to 

these authors, inevitably, a randomized controlled trial of 

vitamin D in hemodialysis patients is needed. Conversely, 

in a large number of patients who were followed for a 

period of a few years, it has been seen a dose dependent 

advantage for those receiving paricalcitol treatment 14 . Finally, 

even per os administration of VDR activators has 

been proven beneficial in hemodialysis patients, and has 

been associated with improved cardiovascular, infectious, 

neoplastic and overall mortality 15 . 

Interestingly, in a study sample of more than 3,000 

people from the general population, who were scheduled 

for coronary angioplasty, the authors observed a much 

higher all cause (HR= 2.08) and cardiovascular mortality 

(HR= 1.53) for those with lower levels of vitamin D 16 . 

All things considered, VDR activation seems to play 

a key role in human survival, even though solid evidence 

will be provided by future randomized studies. 

The Role of VDR Activation on SHPT and 

Cardiovascular Outcome 

For many years, the administration of calcitriol has 

been the mainstay of treatment for SHPT in CKD patients 

17 . However, several novel findings and issues have 

substantially influenced nephrologists` attitudes towards 

VDRAs administration in recent years. High serum calcium 

(Ca) and phosphate (P) levels have been convincingly 

associated with reduced survival in CKD patients 18 . 

Moreover, Tonelli et al investigated the impact upon 

outcome of even small increases in serum P levels at the 

time of an acute myocardial infarction. They found an 

association of higher - but still within the normal range 

- P levels with the occurrence secondary cardiovascular 

events in non-dialysis patients 19 . VC may result from 

high dosages of vitamin D administration, as seen in several 

animal models with renal insufficiency 19 . Moreover, 

some evidence exists that previous calcitriol treatment in 

humans with advanced CKD is one of the VC promoting 

factors 20 . 

There is consistent observational data available that 

the administration of active vitamin D in dialysis patients 

and patients with advanced renal failure is associated 

with improved survival, irrespective of underlying P and 

COZZOLINO M 

Ca levels 21 . This survival improvement may be attributable 

to both the traditional bone and mineral actions 

of vitamin D as well as to the pleiotropic actions. As a 

consequence of these divergent statements, and since 

prospective, randomized data are missing, nephrologists 

might well get “lost in translation” if they try to transfer 

all the available experimental and observational data into 

every-day patient care. Currently, the bedside treatment 

decision for SHPT in CKD is even more complex: In the 

beginning of active vitamin D treatment in ESRD there 

used to be only the simple question: to give calcitriol or 

not to give calcitriol. In contrast, nowadays, there are 

several so-called vitamin D receptor activators (VDRAs) 

available: 1,25-dihydroxy-22-oxavitamin D 3 (22-oxacalcitriol, 

OCT), 1,25-dihydroxy-19-norvitamin D 2 (19norD 

2 , paricalcitol), 1α-hydroxyvitamin D 2 (1αOHD 2 ). 

These novel alternative agents all claim to imitate the 

typical calcitriol action, i.e. reduction of SHPT. On the 

other hand, they deny being comparable to vitamin D regarding 

some other less desirable actions such as induction 

of hypercalcaemia or hyperphosphataemia 17 . 

Numerous observational studies show a clinical advantage 

for VDR activator therapy. To date, no studies 

have demonstrated increased mortality in patients receiving 

VDR activator therapy. Intravenous VDR activator 

therapy confers a survival advantage in patients on dialysis 

17 . Kalantar-Zadeh and coworkers 22 have shown an 

association between any time-varying administered dose 

of paricalcitol and relative risk of death in over 58,000 

maintenance HD patients over 2 years. Moreover, Wolf 

and colleagues 23 have shown in the ArMORR prospective, 

cross-sectional studies that 1,25-D and 25D deficiencies 

in incident HD patients are associated with an 

increased mortality risk that is reduced following the 

introduction of VDR activator therapy given in conjunction 

with dialysis. The association of improved survival 

with VDR activation therapy can already be observed in 

patients with moderate renal impairment. VDR activators 

directly affect cardiovascular outcomes, apparently by 

mechanisms independent of SHPT. These include effects 

on the immune system, RAS, and development of atherosclerosis, 

cardiac remodelling, and LVH. 

Conclusions 

A mounting body of evidence indicates that a deficiency 

in vitamin D and VDR activation play a crucial 

role in CKD, as well as cardiovascular outcomes in both 

CKD patients and the general population. VDR activation 

pathways mediate widespread activities that include 

the maintenance of and interrelated effects between cardiovascular 

and renal integrity. Preclinical and clinical 

data continue to support that when VDR activators are 

used at clinically relevant doses, an efficacious response 

is shown with minimal risk of vascular calcification. Adverse 

effects such as hypercalcemia and phosphatemia are 

further lessened with the use of selective VDR activators. 

In addition, selective VDR activation differentially exerts 

a number of ameliorative effects on parameters outside

of cardiovascular and renal disease, such as immunologic 

effects. Some data now suggest that recognition of CKD 

and cardiovascular interrelated effects requires cumulative 

assessment of patient health for the appropriate selection 

of treatments that may influence patient survival. 

These data underline the need for early identification of 

vitamin D deficiency and clear management strategies. 

Data continue to accrue to help define the many potentially 

beneficial physiologic effects of VDR activators in 

CKD patients with CKD or CVD. 

References 

1. Go AS, Chertow GM, Fan D, McCulloch CE, Hsu C. Chronic 

kidney disease and the risks of death, cardiovascular events, and 

hospitalization. N Engl J Med. 2004; 351: 1296-1305. 

2. Keith DS, Nichols GA, Gullion CM, Brown JB, Smith DH. 

Longitudinal follow-up and outcomes among a population with 

chronic kidney disease in a large managed care organization. 

Arch Intern Med. 2004; 164: 659-663. 

3. Cozzolino M, Galassi A, Gallieni M, Brancaccio D. Pathogenesis 

and treatment of secondary hyperparathyroidism in dialysis 

patients: the role of paricalcitol. Curr Vasc Pharmacol. 2008; 6: 

148-153. 

4. Levin A, Bakris GL, Molitch M, Smulders M, Tian J, Williams 

LA, et al. Prevalence of abnormal serum vitamin D, PTH, calcium, 

and phosphorus in patients with chronic kidney disease: 

results of the study to evaluate early kidney disease. Kidney Int. 

2007; 71: 31-38. 

5. Tentori F, Hunt WC, Stidley CA, Rohrscheib MR, Bedrick EJ, 

Meyer KB, et al. Mortality risk among hemodialysis patients 

receiving different vitamin D analogs. Kidney Int. 2006; 70: 

1858-1865. 

6. Dusso AS, Brown AJ, Slatopolsky E. Vitamin D. Am J Physiol 

Renal Physiol. 2005; 289: F8-F28. 

7. Nakane M, Ma J, Rose AE, Osinski MA, Wu-Wong JR. Differential 

effects of vitamin D analogs on calcium transport. J 

Steroid Biochem Molec Biol. 2007; 103: 84-89. 

8. Joist HE, Ahya SN, Giles K, Norwood K, Slatopolsky E, Coyne 

DW. Differential effects of very high doses of doxercalciferol 

and paricalcitol on serum phosphorus in hemodialysis patients. 

Clin Nephrol. 2006; 65: 335-341. 

9. Martin KJ, Gonzalez EA, Gellens M, Hamm LL, Abboud H, 

Lindberg J. 19-Nor-1-alpha-25-dihydroxyvitamin D2 (Paricalcitol) 

safely and effectively reduces the levels of intact parathyroid 

hormone in patients on hemodialysis. J Am Soc Nephrol. 1998; 

9: 1427-1432. 

10. Wolf M, Shah A, Gutierrez O, Ankers E, Monroy M, Tamez H, 

et al. Vitamin D levels and early mortality among incident hemodialysis 

patients. Kidney Int. 2007; 72: 1004-1013. 

HIPPOKRATIA 2010, 14, 1 9 

11. Teng M, Wolf M, Ofsthun MN, Lazarus JM, Hernán MA, Camargo 

CA Jr, et al. Activated injectable vitamin D and hemodialysis 

survival: a historical cohort study. J Am Soc Nephrol. 

2005; 16: 1115-1125. 

12. Young EW, Albert JM, Akiba T, et al. Vitamin D therapy and 

mortality in the Dialysis Outcomes and Practice Patterns Study 

(DOPPS). J Am Soc Nephrol. 2005; 16: 278A. 

13. Tentori F, Albert JM, Young EW, Blayney MJ, Robinson BM, 

Pisoni RL, et al. The survival advantage for hemodialysis patients 

taking vitamin D is questioned: findings from the Dialysis 

Outcomes and Practice Patterns Study. Nephrol Dial Transpl. 

2009; 24: 963-972. 

14. Shinaberger CS, Kopple JD, Kovesdy CP, McAllister CJ, van 

Wyck D, et al. Ratio of paricalcitol dosage to serum parathyroid 

hormone level and survival in maintenance hemodialysis 

patients. Clin J Am Soc Nephrol. 2008; 3: 1769-1776. 

15. Naves-Dνaz M, Alvarez-Hernαndez D, Passlick-Deetjen J, 

Guinsburg A, Marelli C, Rodriguez-Puyol D, et al. Oral active 

vitamin D is associated with improved survival in hemodialysis 


16. Dobnig H, Pilz S, Scharnagl H, Renner W, Seelhorst U, Wellnitz 

B, et al. Independent association of low serum 25-hydroxyvitamin 

D and 1,25-dihydroxyvitamin D levels with all-cause and 

cardiovascular mortality. Arch Intern Med. 2008; 168: 1340- 

1349. 

17. Cozzolino M, Fallabrino G, Pasho S, Olivi L, Ciceri P, Volpi E, 

et al. Importance of Vitamin D Receptor Activation in Clinical 

Practice. Contrib Nephrol. 2009; 163: 213-218. 

18. Ganesh SK, Stack AG, Levin NW, Hulbert-Shearon T, Port FK, 

et al. Association of elevated serum PO(4), Ca x PO(4) product, 

and parathyroid hormone with cardiac mortality risk in chronic 

hemodialysis patients. J Am Soc Nephol. 2001; 12: 2131-2138. 

19. Tonelli M, Sacks F, Pfeffer M, Gao Z, Curhan G. Relation between 

serum phosphate level and cardiovascular event rate in 

people with coronary disease. Circulation. 2005; 112: 2627- 

2633. 

20. Henley C, Colloton M, Cattley RC, Shatzen E, Towler DA, 

Lacey D, et al. 1,25-Dihydroxyvitamin D3 but not cinacalcet 

HCl (Sensipar/Mimpara) treatment mediates aortic calcification 

in a rat model of secondary hyperparathyroidism. Nephrol Dial 

Transplant. 2005; 20: 1370-1377. 

21. Civilibal M, Caliskan S, Adaletli I, Oflaz H, Sever L, Candan C, 

et al. Coronary artery calcifications in children with end-stage 

renal disease. Pediatr Nephrol. 2006; 21: 1426-1433. 

22. Kalantar-Zadeh K, Kuwae N, Regidor DL, Kovesdy CP, Kilpatrick 

RD, Shinaberger CS, et al. Survival predictability of timevarying 

indicators of bone disease in maintenance hemodialysis 


23. Wolf M, Betancourt J, Chang Y, Shah A, Teng M, Tamez H, et 

al. Impact of activated vitamin D and race on survival among 

hemodialysis patients. J Am Soc Nephrol. 2008; 19: 1379- 

1388.


Systems biology in heart diseases 

Louridas GE, Kanonidis IE, Lourida KG 

PASCHOS KA 

Cardiology Department, Aristotle University of Thessaloniki, Greece 

REVIEW ARTICLE 

Abstract 

Systems biology based on integrative computational analysis and high technology is in a position to construct networks, 

to study the interactions between molecular components and to develop models of cardiac function and anatomy. 

Clinical cardiology gets an integrated picture of parameters that are addressed to ventricular and vessel mechanics, 

cardiac metabolism and electrical activation. The achievement of clinical objectives is based on the interaction between 

modern technology and clinical phenotype. In this review the need for more sophisticated realization of the structure and 

function of the cardiovascular system is emphasized while the incorporation of the systems biology concept in predicting 

clinical phenotypes is a promising strategy that optimize diagnosis and treatment in cardiovascular disease. Hippokratia 

2010; 14 (1): 10-16 

Key words: systems biology, cardiac models, network biology, clinical phenotypes 

Corresponding author: Louridas George, 6 Adrianoupoleos Street, 551 33 Kalamaria, Thessaloniki, Greece, Tel:+302310347049, e-mail: 

louridasg@gmail.com 

In the latter part of the last century, biology was driven 

by reductionist concepts that concerned with information 

originating from the interactions of genes and molecules. 

A novel conceptual idea developed over the last 

few years with the purpose of understanding biological 

processes which were not explained fully by the properties 

of genes and molecules. Both evolutionary theories 

over many decades and systems biology recently have 

transformed the consensus of biology. 

Systems biology (SB) is a new discipline which tries 

to explain the biological phenomenon not only with delineation 

of the function of genes and molecules but by 

reconstructing biochemical supramolecular networks 

that represent various cellular functions. Systems biology 

concern with biochemical networks is focused on their 

functional status and on the nature of the links connecting 

the molecules of the network 1 . This concept considers 

the biological networks as ‘systems’ of cooperating and 

interacting components with complex behaviors. 

This novel approach is transforming the way of thinking 

in research, biology and disease. Network modeling 

could explain cardiovascular metabolism and thus design 

new diagnostic and therapeutic tools. Also the SB perspective 

could help to predict and treat complex diseases 

such as heart failure, metabolic syndrome and diabetes 

mellitus. 

Biological components and systems analysis 

In the second half of the previous century after the 

discovery of the DNA construction, attention focused on 

explaining the cellular function and the chemical composition 

of isolated biological components (gene, protein, 

pathways). This reductionist tendency was increased 

with the advent of genomics and proteomics. The DNA 

sequences in a large number of organisms are known but 

their function at the moment is incomplete. The proteomic 

technology is important in predicting the activation of 

some particular genes but remains still in its infancy. 

The recent advent of integrative analysis of the different 

gene products, the new experimental technologies, 

and in particular the notion that the cells are organized 

in systems has forced biologists to give special attention 

to the systems properties. This shift of focus from individual 

cellular components to systems properties and tissue 

organization is an inexorable process that eventually 

would apply to the study of tissue and organ functions. 

The appearance of novel systems properties in cellular, 

tissue or organ level, are considered properties emerging 

from the complex metabolic and regulatory networks of 

tissues and organs and are not properties of distinct cellular 

components. 

There is a hierarchical coordination that in steps or 

levels involves genes, genetic products, cellular functions, 

tissues and organs. There is not a simple relationship between 

genes but rich biological networks that transform 

genetic potential into phenotypic reality. The coordinated 

function at each level between the different components 

produces a kind of circuit. The term “genetic circuit” was 

used to designate a collection of different gene products 

executing a particular cellular function 1 . Genetic circuits 

are responsible for information processing, metabolism, 

cellular function and evolution. Therefore the integrated 

functions of many genetic circuits form the basic material 

for cellular function and tissue as well as organ coordinated 

operation. 

In a similar way with the molecular biology and the 

complex metabolic and regulatory networks, the scientific 

pursuit can extend to tissue and organ functional

coordination in the different levels of the hierarchical 

ladder. The advances in bioinformatics and clinical phenotype 

make plausible this kind of research and application 

2-4 . 

The proceeding steps of systems biology 

The process leading to the emergence of SB is a new 

paradigm of holistic decoding of biological systems function 

and consists of four principal steps 1 : a) Enumeration 

of biological components participating in the process 

including the plurality of –omics (Genome, Transcriptome, 

Proteome, Metabolome). b) Interaction diagrams 

between these biological components are depicted and 

the constructed cellular networks are demonstrated. Such 

examples of biological networks are gene and proteomic 

networks, immunological networks, and metabolomic 

and disease networks. c) Reconstructed networks are 

analyzed and the biological functions are predicted. d) 

The above emerging models should predict experimental 

outcomes and explore the phenotypic space. 

The universal theories of networks by Barabasi et al 

emphasized that the cell functional organization is based 

on biological similar networks that comply with universal 

laws ruling complex systems 5-7 . 

It is likely that the SB from the level of genome-cell 

exploration would advance to the broader field of an 

organismic concept. This broader field of SB from the 

networks of cellular interactions would be directed to 

the diverse phenotypic space of tissues and organs. The 

previous mentioned hierarchical thinking starts from the 

DNA and continues to the systemic two-dimensional 

genome-scale stoichiometric matrix. The hierarchical 

structure extends from introns, exones, alleles and other 

components of DNA scale, through a network of chemical 

reactions, modules and pathways, to tissue functional 

organization and organ cooperation. 

The cardiovascular (CV) disorders have the highest 

mortality rates in the world, change the quality of life 

and increase the economic burden of the society. Therefore 

there is great significance to understand the cellular 

and molecular alterations that influence the progression 

of cardiac pathologies. Systems biology is an important 

current area of biological research and the practical application 

of the accumulated molecular and cellular knowledge 

can give some answers to the field of cardiology. 

In this overview we summarize the most important areas 

of cardiac systems biology as a new approach to decode 

cardiovascular diseases. The tools of SB are ideal for 

analyzing the complex molecular programs involved in 

regulatory cardiac networks. 

Systems biology components (-omics) in cardiology 

The discipline of SB has evolved after progress was 

made in molecular biology, new technologies and understanding 

of complex metabolic and regulatory networks. 

Important studies have been directed at genome, proteome, 

transcriptome and metabolome connecting DNA 

with messenger RNA, intracellular proteins and metabo- 


lites. The accumulated and informative data should be 

integrated as the need has emerged for the construction 

of a functional cellular model 8 . 

Genomic studies produced an extensive list of genes 

connected with the heart in various physiological and 

disease states and in a variety of temporal stages and spatial 

locations. In some studies genes have been identified 

and expressed in different diseases encoding special proteins 

9 . These genes were responsible for sarcomeric and 

cytoskeletal proteins, stress proteins and calcium regulators 

10 . The failure of the molecular and genetic research 

to explain fully a complex disease like heart failure or 

coronary heart disease soon became evident and thus the 

utilization of genomics directed at the functional genomics 

attempted to fill the existing gaps of our understanding 

11 . 

A review article was addressed to all ‘Programs for 

Genomic Application’ (PGA s ) that was designed for the 

advancement of functional genomic research in the field 

of cardiovascular diseases 12 . The Cardio Genomics program 

was assigned to study the transcriptional network of 

the cardiovascular system under genetic, environmental 

and disease stresses. This program was addressed to the 

transcriptional features of murine models of cardiomyopathy 

and human myocardium, and to gene mutations 

that are responsible for familial hypertrophic cardiomyopathy. 

Genes and their function are unable to explain the 

functional complexity of a whole organ or organism as 

multiple proteins are produced by decipherment of one 

gene while many proteins are modified. Therefore it 

seems that the proteomics can play a significant role in 

explaining many cardiac cellular phenotypes. The cellular 

genotype is regulated by the DNA system, while the 

cellular phenotype is arranged by the available protein 

content. The proteomics technology improved the cognition 

of the molecular mechanisms responsible for the 

protein emergence and investigated the pathologies in the 

cardiovascular system (CVS). The proteomics technology 

using many experimental techniques inquired into 

the diseased proteome and was most informative about 

cardiovascular biomarkers 13-16 . 

The biomarkers provide more accurate and sensitive 

potential than clinical assessment in the identification and 

characterization of cardiovascular diseases 17 . Biomarkers 

are turned out as an important adjunct to clinical evaluation 

in the CVS and may be molecular in nature (hormone 

concentration, genome, protein expression) or reveal organ 

function (pulmonary or systemic artery pressure) 18,19 . 

While proteomics is still a new discipline, it is emerging 

as a technique for screening biomarkers in cells, tissues 

and fluids. Proteomics also identified candidate proteins 

altered in pathological states like atherosclerosis, dilated 

cardiomyopathy and ischemia/reperfusion injury. 

Despite the above facts the wide clinical application 

of these biomarkers for preventive medicine is limited at 

the moment for various reasons: 1) absence of information 

on the prevalence and risk contribution of these markers

across population; 2) inadequate data of biomarkers inheritance 

and how they affect individual ’ s risk for various 

diseases; 3) limited knowledge on how genetic risk factors 

interact with environmental factors; and 4) further 

interventional studies are not considered to test the effect 

of genetic risk factors on common diseases 4 . 

The use of metabolomics to genetic/chemical interventions 

and the way that it can be integrated with other 

–omics technologies demonstrated the importance of 

nuclear magnetic resonance (NMR) in defining metabolic 

profiles of intact cardiac tissues and linking them to 

phenotypes 20 . Grainger DJ studied the metabolic profiling 

generated by using NMR spectroscopy as a diagnostic 

test for cardiovascular diseases like identification of 

individuals who will suffer a myocardial infarction 21 . 

Recently some novel cardiac genes were identified 

and characterized with the help of libraries of transcript 

data and use of integrative methods 22-24 . The newly discovered 

genes are involved in mitochondrial functions, 

calcium metabolism and gene transcription which are 

expected to be useful in future cardiovascular research. 

In cardiac research the SB concept could be realized 

only if data can be gathered in different levels-genome, 

proteome, metabolome. More information for higher 

functional and interactive levels depends on advanced 

molecular genetics that cannot be done in man due 

mainly to ethical reasons 8 . This kind of genetic studies 

can be performed in other mammals but up today the 

only cardiac mammalian cell line are atria-derived HL1 

cells from the adult mouse 25 . Non-mammalian model 

organisms recently are involved in functional molecular 

studies with the intention of solving complex biological 

problems. This is a rational experimental strategy of 

systemic biology that could be extended to human cardiovascular 

research 26 . 

Databases and integration 

The genomic and proteomic data are voluminous but 

understanding their functions in a complex system like 

the heart is a difficult task often based on genetic manipulation 

and gene targeting in model organisms like 

the mouse or simpler organisms. This kind of simpler 

organisms are Escherichia coli, Caenorhabditis elegans, 

and Saccharomyces cerevesiae 27,28 . One of the differences 

of approach between the two kinds of organisms is the 

time of study. A single transgenic mouse takes months 

to develop and study while a knockout mouse takes over 

a year making studies very long and costly 29 . The simpler 

organisms are amenable to large scale mutagenesis 

and rapid phenotyping (genomic phenotyping) while 

the phenotypic characteristics can be analyzed for genome 

mutant libraries and a large number of alleles can 

be stored for further investigation 29 . The integration of 

pnenotypic information with genomic or proteomic data 

can detect novel pathways and identify new networks. 

In S.cerevesiae the identification of new alleles important 

for cellular recovery and the integration with phenotypic 

data on cell recovery managed to detect several 

LOURIDAS GE 

protein networks significant for damage recovery 28 . Also 

it was discovered that some networks were associated 

with DNA metabolism and repair, but most of them were 

found to possess unexpected functions concerning the cytoskeletal 

remodeling and lipid metabolism. 

Therefore the molecular diagnostics integrated with 

phenotypic characteristics give us the best chance of 

coming up with the right picture of SB. Probably this data 

integration will help in the study of cardiac biology with 

a holistic approach. There are several experimental data 

attempting to use Drosophila melanogaster for research 

in the field of cardiac dysfunction 30,31 . The fruit fly (Drosophila 

melanogaster) was the first organism with an active 

circulation with its genome sequenced 32 . Drosophila 

was proposed many times as a human disease model and 

several of these models were examined, particularly for 

neurological diseases, genetics of aging and adult cardiac 

dysfunction 30-33 . Human medicine and biology was enriched 

with many important findings emanated from studies 

in Drosophila or other invertebrates. Some important 

findings are the detection of genes regulating embryonal 

development in Drosophila, the identification of many 

components of the apoptotic machinery and the recognition 

of gene pathways involved in neurogenesis 34-36 . A 

Drosophila model suitable for studies in humans is the 

model with decline of the maximum heart rate with aging, 

a significant sign of cardiac dysfunction and a cause 

of restricted physical work in the elderly 37 . 

The heart is a complex system and the descriptive 

study of its molecular components and individual pathways 

is not adequate without integrating all the informations 

enclosed in different databases (Figure 1). The data 

integration is achieved with different proteomic and metabolomic 

techniques 38,39 . H-NMR spectroscopy is used 

to combine proteomics and metabolomic analyses while 

the joined use of proteomic and metabolomic techniques 

succeeded in the integrated assessment of enzymes and 

their corresponding metabolites. Worldwide there are 

various databases that accumulate impressive amount 

of biological material, but the use of these databases is 

nearly impossible as the included material must be gathered 

manually 40-47 . The only method for extraction of useful 

biological information is the integration of the data 

from different sources with cross-correlation, analysis 

and attainment of functional networks. The larger fraction 

of the biological information is included in general 

databases while the number of the databases addressed 

specifically to cardiology research is restricted 48-50 . At the 

present time another comprehensive database is required 

to integrate the gathered volume of –omics material with 

other information such as kinetic data and mathematical 

models 8 . The Cardiac Integrated Database Management 

System (CIDMS) is considered as a database for genes 

expressed in the heart 51 . 

Cardiac networks 

Previous theoretical studies have demonstrated the 

main aspects of evolution and deduced a simple relation-

ship between genes and reproduction. This assumption 

neglected the important biological networks that operate 

during morphogenesis and development and the capacity 

to convert genetic potential into phenotypic actuality. 

Biological and mathematical methods and models 

have been developed to explore the interaction between 

networks, evolution and phenotypic variations. These 

methods were able to reconstruct the biochemical reaction 

networks of the cells and tissues. The reconstruction 

process of metabolic, regulatory and signaling networks 

are concerned with the chemical reactions or interactions 

that comprise these networks. All these networks are not 

independent but they interact between themselves and 

produce the complex biological phenotype 1 . 

Different types and properties of biological networks 

have been recorded and published in the literature 52,53 . Extensive 

biological networks were constructed and studied 

in simple biological systems like bacteria and yeast but 

the cardiovascular networks in humans and other mammals 

are still under development as no large-scale analysis 

of these networks has been undertaken. That is due 

probably to inadequate knowledge about interactions between 

metabolic networks and signaling pathways. Metabolism 

includes the breakdown of molecules for energy 

and the synthetic ability for metabolites, while signaling 

conducts information. A cardiovascular metabolism 

network has been described that presented cardiovascular 

metabolism as an interactive and capable network of 

metabolites designed for regular and predictable energy 

delivery 54 . Drake et al produced a network modeling integrating 

the CVS genetic system of the mouse with gene 

expression data 55 . In a recent study it was demonstrated 

how a network analysis of human coronary artery In- 


Figure 1: Systems biology schedule 

Formulation of initial components from original experimental data and integration in higher-level databases. The construction 

of mathematical or biological models precipitates new experiments to acquire new biological parameters which are incorporated 

and simultaneously modify the models. 

Stent Restenosis (ISR) unraveled significant components 

of biological pathways that could be targeted for future 

therapeutic intervention 56 . 

Cardiac myocyte models 

The first endeavor for a cardiac myocyte model was 

the description of the cardiac action and pacemaker potentials 

based on the Hodgkin-Huxley equations 57-58 . This 

model evaluated the sodium and potassium currents during 

the action potential and described also the mechanistic 

basis of the plateau of the action potential. The more 

recent cardiac myocyte ionic models include twenty ionic 

fluxes and more than forty differential equations 29 . These 

models are actually functionally integrated systems models 

because they incorporate different separate cellular 

compartments such as the sarcoplasmic reticulum and the 

dyadic subsarcolemmal space. 

Other systems models integrate functional components 

of cellular subsystems connected with calcium handling, 

energy production and myocardial filament interactions. 

Then more complex systems models are created 

with the functional integration of more than two of the 

above systems models. An example of this kind of complex 

interaction and integration is the excitation-contraction 

(E-C) coupling model correlating electrophysiological 

with energy metabolism models. Some of this kind of 

energy-mechanistic E-C coupling systems models have 

been described during the last thirty years 59 . 

Recently a thermokinetic model was developed explaining 

the cardiac mitochondrial bioenergetic behavior 

incorporating information and differential equations 

for the oxidative phosphorylation, the tricarboxylic acid 

cycle and mitochondrial calcium handling 60 .

Cardiac systems models 

The use of the classical experimental methodology 

to understand the biological systems often encounters 

difficulties particularly in complex pathophysiological 

circumstances. Then computational models and simulation 

can help to provide a quantitative interpretation of 

biological networks and signaling pathways. Simulation 

of normal and disease conditions performed on or 

via computer simulation (“in silico”) can formulate new 

hypotheses and predict biological functional differences. 

These models include a wide range of biological systems 

in the level of genomics, proteomics, cells, tissues and organs. 

In cardiac biology and signaling networks this kind 

of models have been used with success in normal and 

diseased situations 61,62 . 

The mechanistic system models are low abstraction 

models that typically codify biochemical reactions, with 

kinetic rate laws as differential equations, from experimental 

data. They incorporate quantitative information 

that flows from one biological component to another and 

can make quantitative predictions experimentally testable 

29 . 

These quantitative models proved efficient in explaining 

cardiac systems behavior which is confirmed 

with many such examples. Soulis et al investigated the 

wall shear stress oscillation in a normal human left coronary 

artery bifurcation computational model by applying 

non-Newtonian blood properties and phasic flow. They 

found that the lateral walls of the bifurcation, where low 

and oscillating wall shear stress is observed, are more 

susceptible to atherosclerosis 63 . Chatzizisis et al demonstrated 

that the geometrically correct three-dimensional 

reconstruction of human coronary arteries by integrating 

intravascular ultrasound and biplane angiography 

constitutes a promising imaging method for coronaries 

for either diagnostic or investigational purposes 64 . Hoffmann 

et al.predicted functional differences between IkB 

isoforms in computer simulation and this model tested 

experimentally proving the above prediction 65 . Bhalla 

and Iyengar demonstrated that feedback and crosstalk 

between neuronal signaling pathways could direct to 

emergent properties like bistability 66 . Luo et al used a 

model of an energetic metabolic network in mammalian 

myocardial cells and reconstructed it under normal and 

ischemic conditions. They indicated through simulation 

that the metabolic networks in myocardial cells under 

ischemic conditions do not maximize the production of 

ATP but attain a suboptimal level of energy production 

adapted to a moderate survival response 67 . 

Models of whole heart phenotype 

Computational multicellular models have been useful 

in formally explaining the propagation of AP in the 

intracellular and extracellular domains. Drug induced QT 

prolongation has been studied in model systems designed 

to clarify the mechanisms of malignant arrhythmias in 

the genetic long Q-T syndromes (LQTS S ) associated with 

high mortality and mutations of genes encoding the fast 

LOURIDAS GE 

and slow potassium channels (I Kr and I Ks ) and the fast 

sodium channel(I Na ) 68 . Anatomical models of ventricular 

geometry and muscle fiber construction have been built 

up in animals and man improving the understanding of 

cardiac electrical impulse propagation and wall mechanics 

69-71 . The cardiac models are structurally or functionally 

integrated models enquiring about structural organization, 

voltage-gated channels, membrane transportation, force 

generation and SB application to study the mitochondria 

and the functional significance of proteomics 72-74 . 

A recent publication concerning the 4 th Fairberg Workshop 

examined the various functional interactions in the 

cardiac system and explored the analytical approaches to 

the integration of the single and multiscale phenomena 75 . 

The goals of these Workshops are a) the interdisciplinary 

interaction: b) the relation of the basic phenomena 

to cardiac phenotype: c) the application of conceptual 

modeling: d) the interpretation of clinical data: and e) the 

enhancement of the international cooperation 75 . 

Conclusions 

Systems biology has transformed the understanding 

of biology and clinical cardiology. The simple relationship 

between genes and disease has been replaced by biological 

networks and/or tissue and organ potential in an 

endeavor to comprehend the clinical phenotypic reality. 

Therefore systems biology represents a very important 

contemporary area of biological research in the field of 

cardiology. 

References 

1. Palsson B.O. Systems biology, 2006 Ed by: Cambridge University 

press, New York. 

2. Heidecker B, Hare JM. The use off transcriptomic bio-markers 

for personalized medicine. Heart Fail Rev. 2007; 12:1-11. 

3. Arab S, Gramolini AO, Ping P, Kislinger T, Stanley B, van Eyk 

J, et al. Cardiovascular proteomics: tools to develop novel biomarkers 

and potential applications. J Am Coll Cardiol. 2006; 48: 

1733-1741. 

4. Feero WG, Guttmacher AE, Collins FC. The genome gets personal 

almost. J Am Med Assoc. 2008; 299: 1351-1352. 

5. Barabasi AL, Bonabeau E. Scale-free networks. Sci Amer. 2003; 

288: 60-69. 

6. Barabasi AL, Oltvai ZN. Network biology: understanding the 

cell’s functional organization. Nat Rev Genet. 2004; 5: 101- 

113. 

7. Barabasi AL, Albert R. Emergence of scaling in random networks. 

Science. 1999; 286: 509-512. 

8. Shreenivasaiah PK, Rho S-H, Kim T, Kim DH. An overview of 

cardiac systems biology. J of Molecular and Cellular Cardiol. 

2008; 44: 460-469. 

9. Barrans JD, Liew CC. Chipping away at heart failure. Methods 

Mol Med. 2006; 126: 157-169. 

10. Liew CC, Dzau VJ. Molecular genetics and genomics of heart 

failure. Nat Rev Genet. 2004; 5: 811-825. 

11. Donahue MP, Marchuk DA, Rockman HA. Redefining heart 

failure: the utility of genomics. J Amer Coll Cardiol. 2006; 48: 

1289-1298. 

12. Winslow RL, Boguski MS. Genome informatics: current status 

and future prospects. Circ Res. 2003; 92: 953-961. 

13. Scobioala S, Klocke R, Michel G, Kuhlmann M, Nikol S. Proteomics: 

state of the art and its application in cardiovascular research. 

Curr Med Chem. 2004; 11: 3203-3218.

14. Arrell DK, Neverova I, Van Eyk JE. Cardiovascular proteomics: 

evolution and potential. Circ Res. 2001; 88: 763-773. 

15. White MY, Van Eyk JE. Cardiovascular proteomics: past, present, 

and future. Mol Diagn Ther. 2007; 11: 83-95. 

16. Matt P, Carrel T, White M, Lefkovits I, Van Eyk J. Proteomics 

in cardiovascular surgery. J Thorc Cardiovasc Surg. 2007; 133: 

210-214. 

17. Vasan RS. Biomarkers of cardiovascular disease: molecular basis 

and practical considerations. Circulation. 2006; 113: 2335- 

2362. 

18. Tang WH, Francis GS, Morrow DA, Newby LK, Cannon CP, 

Jesse RL, et al. National Academy of Clinical Biochemistry Laboratory 

Medicine. National Academy of Clinical Biochemistry 

Laboratory Medicine practice guidelines: clinical utilization of 

cardiac biomarkers testing in heart failure. Circulation. 2007; 116: 

e99-e109. 

19. Adams KF. Introduction: biomarkers in heart failure. Heart Fail 

Rev. 2009; Published online. 

20. Griffin J. Metabolic profiles to define the genome: can we hear 

the phenotypes? Philos Trans R Soc Lond B Biol Sci. 2004; 359: 

857-871. 

21. Grainger DJ. Metabolic profiling in heart disease. Heart Metab. 

2006; 32: 22-25. 

22. Jenuth JP. The NCBI. Publicly available tools and resources on 

the Web. Methods Mol Biol. 2000; 132: 301-312. 

23. Barrett T, Troup DB, Wilhite SE, Ledoux P, Rudnev D, Evangelista 

C, et al. NCBI GEO: mining tens of millions of expression 

profiles-database and tools update. Nucleic Acids Res. 2007; 35: 

D760-765. 

24. Park I, Hong SE, Kim TW, Lee J, Oh J, Choi E, et al. Comprehensive 

identification and characterization of novel cardiac 

genes in mouse. J Mol Cell Cardiol. 2007; 43: 93-106. 

25. White SM, Constantin PE, Claycomb WC. Cardiac physiology 

at the cellular level: use of cultured HL-1 cardiomyocytes 

for studies of cardiac muscle cell structure and function. Am J 

Physiol Heart Circ Physiol. 2004; 286: H823-829. 

26. Hu N, Sedmera D, Yost HJ, Clark EB. Structure and function of 

the developing Zebrafish heart. The Anatomical Record. 2000; 

260: 148-157. 

27. Singer JB, Hill AE, Burrage LC, et al. Genetic dissection of 

complex traits with chromosome substitution strains of mice. 

Science. 2004; 304: 445-448. 

28. Begley TJ, Rosenbach T, Ideker T, Samson LD. Damage recovery 

pathways in Saccharomyces cerevisiae revealed by genomic 

phenotyping and interactome mapping. Mol Cancer Res. 2002; 

1: 103-112. 

29. McCulloch AD, Paternostro G. Cardiac systems biology. Ann 

NY Acad Sci. 2005; 1047: 283-295. 

30. Lakatta EG. Heart aging: a fly in the ointment? Circ Res. 2001; 

88: 984-986. 

31.Paternostro G, Vignola C, Bartsch DU, et al. Age-associated cardiac 

dysfunction in Drosophila melanogaster. Circ Res. 2001; 

88: 1053-1058. 

32. Adams MD, Celniker SE, Holt RA, et al. The genome sequence 

of Drosophila melanogaster. Science. 2000; 287: 

2185-2195. 

33. Fanny MB, Bender WW. A Drosophila model of Parkinson’s 

disease. Nature. 2000; 404: 394-398. 

34. Nusslein-Volhard C, Wieschaus E. Mutations affecting segment 

number and polarity in Drosophila. Nature. 1980; 287: 795- 

801. 

35. White K, Grether ME, Abrams JM, et al. Genetic control of 

programmed cell death in Drosophila. Science. 1994; 264: 677- 

683. 

36. Artavanis-Tsakonas S, Muskavitch MA, Yedvobnick B. Molecular 

cloning of Notch, a locus affecting neurogenesis in 

Drosophila melanogaster. Proc Natl Acad Sci USA. 1983; 80: 

1977-1981. 

37. Lakatta EG. Introduction: chronic heart failure in older persons. 


Heart Fail Rev. 2002; 7: 5-8. 

38. Joyce AR, Palsson BO. The model organism as a system: integrating-‘omics’ 

data sets. Nat Rev Mol Cell Biol. 2006; 7: 198- 

210. 

39. Mayr M, Madhu B, Xu Q. Proteomics and metabolomics combined 

in cardiovascular research. Trends in Cardiovasc Med. 

2007; 17: 43-48. 

40. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler 

DL. GenBank . Nucleic Acids Res. 2007; 35: D21-D25 (Database 

issue). 

41. Wheeler DL, Barrett T, Benson DA, Bryant SH, Canese K, Chetvernin 

V, et al. Database resources of the National Center for 

Biotechnology Information. Nucleic Acids Res. 2007; 35: D5- 

D12 (Database issue). 

42. The Universal Protein Resource (UniProt). Nucleic Acids Res. 

2007; 35: D193-D197 (Database issue). 

43. Couto FM, Silva MJ, Lee V, Dimmer E, Camon E, Apweiler R, 

et al. GO annotator: linking protein GO annotations to evidence 

text. J Biomed Discov Collab. 2006; 1: 1-19. 

44. Mishra GR, Suresh M, Kumaran K, Kannabiran N, Suresh S, 

Bala P, et al. Human protein reference database – 2006 update. 

Nucleic Acids Res. 2006; 34: D411-D414 (Database issue). 

45. Kanehisa M, Goto S, Kawashima S, Okuno Y, Hattori M. The 

KEGG resource for deciphering the genome. Nucleic Acids Res. 

2004; 32: D277-D280 (Database issue). 

46. Mulder NJ, Apweiler R, Attwood TK, Bairoch A, Bateman A, 

Binns D, et al. New developments in the InterPro database. Nucleic 

Acids Res. 2007; 35: D224-D228 (Database issue). 

47.Hubbard TJ, Aken BL, Beal K, Ballester B, Caccamo M, Chen Y, 

et al. Ensembl 2007. Nucleic Acids Res. 2007; 35: D610-D617 

(Database issue). 

48. Hong SE, Rho SH, Yeom YI, Kim DH. HCNet: a database of 

heart and calcium functional network. Bioinformatics. 2006; 22: 

2053-2054. 

49. Zhang Q, Lu M, Shi L, Rui W, Zhu X, Chen G, et al. Cardio: a 

web-based knowledge resource of genes and proteins related to 

cardiovascular disease. Int J Cardiol. 2004; 97: 245-249. 

50. Cotter D, Guda P, Fahy E, Subramaniam S. MitoProteome: mitochondrial 

protein sequence database and annotation system. 

Nucleic Acids Res. 2004; 32: D463-D467 (Database issue). 

51.CIDMS: Cardiac Integrated Database Management System, version 

1.0. [online] Available from URL:http://cidms.org. 

52. Zhu X, Gerstein M, Snyder M. Getting connected: analysis and 

principles of biological networks. Genes Dev. 2007; 21: 1010- 

1024. 

53. Bansal M, Belcastro V, Ambesi-Impiombato A, di Bernardo D. 

How to infer gene networks from expression profiles. Mol Syst 

Biol. 2007; 3: 78-88. 

54. Weiss JN, Yang L, Qu Z. Systems biology approaches to metabolic 

and cardiovascular disorders: network perspectives of cardiovascular 

metabolism. J Lipid Res. 2006; 47: 2355-2366. 

55. Drake TA, Schadt EE, Lusis AJ. Integrating genetic and geneexpression 

data: application to cardiovascular and metabolic 

traits in mice. Mamm Genome. 2006; 17: 466-479. 

56. Ashley EA, Ferrara R, King JY, Vailaya A, Kuchinsky A, He X, 

et al. Network analysis of human in-stent restenosis. Circulation. 

2006; 114: 2644-2654. 

57. Noble D. Cardiac action and pacemaker potentials based on the 

Hodgkin-Huxley equations. Nature. 1960; 188: 495-497. 

58. Hodgkin AL, Huxley AF. A quantitative description of membrane 

current and its application to conduction and excitation in 

nerve. J Physiol. 1952; 117: 500-544. 

59. Rice JJ, de Tombe PP. Approaches to modeling crossbridges and 

calcium dependent activation in cardiac muscle. Prog Biophys 

Mol Biol. 2004; 85: 179-195. 

60. Cortassa S, Aon MA, Marban E, et al. An integrated model of 

cardiac mitochondrial energy metabolism and calcium dynamics. 

Biophys J. 2003; 84: 2734-2755. 

61. Ideker T, Lauffenburger D. Building with a scaffold: emerging

strategies for high- to low-level cellular modeling. Trends Biotechnol. 

2003; 21: 255-262. 

62. Ideker T, Ozier O, Schwikowski B, Siegel AF. Discovering regulatory 

and signaling circuits in molecular interaction networks. 

Bioinformatics. 2002; 18: S233-S240. 

63. Soulis JV, Giannoglou GD, Chatzizisis YS, Farmakis TM, Giannakoulas 

GA, Parcharidis GE, et al. Spatial and phasic oscillation 

of non-Newtonian wall shear stress in human left coronary 

artery bifurcation: an insight to atherogenesis. Coronary Artery 

Dis. 2006; 17: 351-358. 

64. Chatzizisis YS, Giannoglou GD, Matakos A, Basdekidou C, Sianos 

G, Panagiotou A, et al. In-vivo accuracy of geometrically 

correct three-dimensional reconstruction of human coronary arteries: 

is it influenced by certain parameters? Coronary Artery 

Dis. 2006; 17: 545-551. 

65. Hoffmann A, Levchenko A, Scott ML, Baltimore D. The IkappaB-NF-kappaB 

signaling module: temporal control and selective 

gene activation. Science. 2002; 298: 1241-1245. 

66. Bhalla US, Iyengar R. Emergent properties of networks of biological 

signaling pathways. Science. 1999; 283: 381-387. 

67. Luo RY, Liao S, Tao GY, Li YY, Zeng S, Li YX, et al. Dynamic 

analysis of optimality in myocardial energy metabolism under 

normal and ischemic conditions. Mol Syst Biol. 2006; 2: 

2006.00031. 

LOURIDAS GE 

68. Saucerman JJ, Healy SN, Belik ME, Puglisi JL, McCulloch AD, 

Proarrhythmic consequences of a KCNQ1 AKAP-binding domain 

mutation. Computational models of whole cells and heterogeneous 

tissue. Circ Res. 2004; 95: 1216-1224. 

69. Stevens C, Hunter PJ. Sarcomere length changes in a 3D mathematical 

model of the pig ventricles. Prog Biophys Mol Biol. 

2003; 82: 229-241. 

70. Harrild D, Henriquez C. A computer model of normal conduction 

in the human atria. Circ Res. 2000; 87: E25-E36. 

71. Xie F, Qu Z, Yang J, Baher A, Weiss JN, Garfinkel A. A simulation 

study of the effects of cardiac anatomy in ventricular fibrillation. 

J Clin Invest. 2004; 113: 686-693. 

72. Noble D, Rudy Y. Models of cardiac ventricular action potentials: 

iterative interaction between experiment and simulation. 

Philos Trans: Mats, Phys and Engi Sci. 2001; 359: 1127- 

1142. 

73. Winslow RL, Greenstein JL. The ongoing journey to understand 

heart function through integrative modeling. Circ Res. 2004; 95: 

1135-1136. 

74. Vo TD, Palsson BO. Building the power house: recent advances 

in mitochondrial studies through proteomics and systems biology. 

Am J Physiol Cell Physiol. 2007; 292: C164-177. 

75. Sideman S. The challenge of cardiac modeling-interaction and 

integration. Ann NY Acad Sci. 2006; 1080: xi-xxiii.


Spondylolysis: A review and reappraisal 



Syrmou E, Tsitsopoulos PP, Marinopoulos D, Tsonidis C, Anagnostopoulos I, Tsitsopoulos PD 

Department of Neurosurgery, Hippokratio General Hospital, Aristotle University, Thessaloniki, Greece 

Abstract 

The aim of this review was to provide of the current knowledge in pathophysiology, diagnosis and management of 

spondylolysis based on the authors’ experience and the pertinent medical literature. 

Spondylolysis represents a weakness or stress fracture in one of the bony bridges that connect the upper with the 

lower facet joints of the vertebra. It is the most common cause of low back pain in young athletes. One-half of all paediatric 

and adolescent back pain in athletic patients is related to various disturbances in the posterior elements including 

spondylolysis. The most common clinical presentation of spondylolysis is low back pain. This is aggravated by activity 

and is frequently accompanied by minimal or no physical findings. A pars stress fracture or early spondylolysis are common 

and a misdiagnosis is often made. 

Plain radiography with posteroanterior (P - A), lateral and oblique views have proved very useful in the initial diagnostics 

of low back pain, but imaging studies such as Computed Tomography (CT) and Magnetic Resonance Imaging 

(MRI) scans are more sensitive in the establishment of the diagnosis. 

Several treatment options are available. Surgical treatment is indicated only for symptomatic cases when conservative 

methods fail. The fact that early and multiple imaging studies may have a role in the diagnosis of pars lesions and 

the selection of the optimal treatment approaches is also highlighted. Hippokratia 2010; 14 (1): 17-21 

Key words: spondylolysis, spondylolisthesis, spine, low back pain, pars interarticularis 

Corresponding author: Syrmou Efstratia, Department of Neurosurgery, Hippokratio General Hospital, 49 Konstantinoupoleos Street, 54642, 

Thessaloniki, Greece, tel: +3(0) 2310 892332, e-mail: esyrmou@gmail.com 

Spondylolysis is defined as a bony defect in the pars 

interarticularis of the vertebral arch. It presents a weakness 

or stress fracture in one of the bony bridges that connects 

the upper with the lower facet joints. This defect can 

either be asymptomatic or associated with significant low 

back pain (LBP). This condition is present in up to 6% 

of the population 1 . Although the aetiology of this lesion 

is still unclear, it has been shown to have both hereditary 

and acquired risk factors, with an increased prevalence in 

men and athletes participating in certain high-risk sports. 

Spondylolysis is indeed, a common cause of low back 

pain in preadolescent and adolescent athletes (50%) and 

it particularly presents a clinical problem in this population 

2 . It occurs with higher frequency in people engaged in 

certain activities that appear to put unusual stress on their 

lower spine. Gymnasts, football linemen, weightlifters, 

wrestlers, dancers, and drivers are the most commonly 

affected individuals. However, primary care practitioners 

should be familiar with its frequency and the possibility 

of progression from a pars interarticularis stress fracture 

to spondylolysis and/or to spondylolisthesis 3-5 . 

The vast majority of spondylolitic defects occur at the 

L5 level (85 - 95%), with L4 being the second most commonly 

involved level (5 – 15%) whereas higher lumbar 

areas are rarely affected 6 . This defect is seen relatively often 

in plain radiographic studies with posteroanterior and 

lateral views, although dynamic and oblique views seem to 

determine the vertebral stability and lead to the diagnosis 7 . 

Spondylolisthesis occurs in a significant proportion 

of individuals with bilateral spondylolysis. It appears 

that approximately 50 - 81% of people suffering from 

spondylolysis have associated spondylolisthesis 1 . This is 

defined as: the complete bilateral fractures of the pars interarticularis 

resulting in the anterior slippage of the vertebra. 

Predicting risk factors for progression of the slip to 

spondylolisthesis has proven to be difficult 6,8 . 

Unfortunately, since a misdiagnosis of spondylolysis 

is often made, an early recognition of this entity is essential. 

A complicating factor in the early stages of the 

disease that leads to a misdiagnosis is the fact that plain 

radiographs, even with oblique films, may not be helpful 

at the stress fracture stage. Other imaging techniques, 

such as bone scan possibly with single photon emission 

computed tomography (SPECT) or magnetic resonance 

image (MRI) should be used early in the diagnostic process. 

In the primary care setting, an early diagnosis of 

posterior element involvement related to low back pain 

either at the stage of pars stress fracture or early spondylolysis 

can prevent progression of the disease and obviate 

the need for an aggressive intervention of a more significant 

defect 9,10 . 

Spondylolysis is subdivided in five categories: dysplastic, 

isthmic, degenerative, traumatic and pathological 

- each representing distinct considerations and characteristics 

for all healthcare providers 3,9,11 . Dysplastic conditions 

involve congenital abnormalities (attenuated pars);

isthmic conditions are lesions in the pars interarticularis 

resulting from stress fractures or acute fractures; - Degenerative 

conditions are related to segmental instability 

and alterations of the articular processes due to degeneration 

of the intervertebral discs; - traumatic spondylolysis 

results from acute fractures in various areas of the neural 

arch, other than the pars. Finally, pathological conditions 

involve various bone diseases, tumours or infections and 

their complications. (Table 1). 

Table 1: Types of spondylolysis 11 . 

Type of 

spondylolysis 

Title Pathogenesis 

Type I Dysplastic Congenital abnormalities 

Type II Isthmic 

Type III Degenerative 

Type IV Traumatic 

Type V Pathological 

Stress fractures in the pars 

interarticularis 

Degeneration of the 

intervertebral discs 

Acute fractures in areas 

other than the pars 

Bone diseases, tumors or 

infections 

The present review focuses primarily on isthmic 

spondylolysis resulting from “stress fractures”, due to 

mechanical stress in the pars interarticularis caused by 

hyperextension and rotation forces, especially during 

stressful exercises 1,3,11,12 . 

Clinical presentation 

In the majority of cases spondylolysis is asymptomatic 

and identified incidentally. Of the symptomatic individuals, 

the major complain is the focal low back pain, 

which frequently radiates into the buttock or proximal 

lower limb. The onset of pain is acute or gradual, after 

an intense athletic activity (lumbar spinal rotation or extension). 

Some patients may also report a recent or old 

history of local trauma. The pain is intense and restricts 

everyday activities. Symptoms typically worsen acutely 

after a particular stressful event 5,6,13,14 . 

Based on the pertinent literature, the only possible 

pathognomonic finding during physical examination, is 

the reproduction of pain by performing the one legged 

hyperextension manoeuvre (the patient stands on one leg 

and leans backwards). Interestingly, unilateral lesions often 

produce pain when standing on the ipsilateral leg 8,15,16 

(Figure 1). 

Diagnosis 

Radiographic studies and other more detailed imaging 

modalities assist in the diagnosis of spondylolysis. 

Several imaging modalities may play a role in the iden- 

SYRMOU E 

Figure 1: The one legged hyperextension manoeuvre. 

tification of a symptomatic pars lesion. The radiographic 

visualisation of a pars lesion is essential in establishing 

the diagnosis of symptomatic spondylolysis 17 . 

Plain radiographs of the spine are always performed, 

in symptomatic spondylolysis or not, mainly to rule out 

underlying specific diagnosis and to describe degenerative 

spine changes. Plain radiographs with posteroanterior and 

lateral views are useful in the initial investigation of low 

back pain, whereas dynamic and oblique views help in the 

determination of vertebral stability 18,19 (Figure 2). 

Figure 2: X-ray oblique views of the Lumbar Spine showing 

the defect in the pars interarticularis at the L4 level.

According to different studies, about 20% of pars 

defects seen on plain radiographs can be identified on 

oblique views only 6 . A common term used for the diagnostic 

description of the neural arch region defect, is the 

visualisation of “the collar on the Scottie dog”. The collar 

indicates the non displaced fracture of the pars interarticularis 

(Figure 3) 6,17,18 . 

Figure 3: Plain radiograph of the lumbar spine. The collar 

17 sign on the Scottie dog . 

In the past, most studies have used plain conventional 

x-rays as the only diagnostic method to determine spondylolysis. 

It should be noted however that they represented an 

important diagnostic tool for a long time since the defect in 

isthmic spondylolysis is visualised as a lucency in the pars 

interarticularis 5 . Standard radiographic examinations are still 

helpful in the diagnosis. They can predict what the prognosis 

will be in terms of the evolution defect and more importantly 

indicate what treatment should be applied, according 

to the degree of the slippage, the slip angle etc. On the other 

hand, the most significant limitation of plain radiographs is 

the lack of orientation from the plane of the defect 5,15,16 . 

Over the past decades, other imaging modalities have 

been increasingly used for diagnosing of spondylolysis. 

These include the Computed Tomography (CT) scan, the 

Single Photon Emission Computed Tomography (SPECT) 

and the magnetic Resonance Imaging (MRI) 20 . All the 

above methods have proven to be more sensitive, in identifying 

pars lesions allowing more complicated angles to be 

taken to accommodate the complex structure of the lower 

spine. These techniques can definitely lead with more ac- 


curacy to the diagnosis of spondylolysis. A bone scan is 

useful in the early stages of spondylolysis. In some studies, 

though, in early spondylolysis, changes in the MRI 

signal intensity in the pars interarticularis may be detected, 

even before fracture lines are visible on plain radiographs. 

Nevertheless, further studies are needed to validate MRI as 

the imaging modality of choice for the early diagnosis of 

spondylolysis. Although, the CT scan and in particular high 

definition multislice devices is the most accurate examination, 

MRI has also become an indispensable diagnostic 

tool 6 . At MRI, most of degenerative disc abnormalities are 

non-specific and are frequently found in the asymptomatic 

subjects. On fat-suppressed T2WI images, the presence of 

oedema in the end-plates in case of degenerative disc disease 

and in the posterior arches when facet arthropathy and 

spondylolysis are present is well-correlated to LBP. Such 

visualised oedema may be useful to direct the treatment approach 

in these patients. (Figure 4) 19,21 . 

Figure 4: T2-weighted MRI of the Lumbar Spine. Changes 

on the signal intensity at the L4 - L5 level indicative of spondylolysis.

According to the pertinent literature, CT best demonstrates 

fracture size and extent, and is the most appropriate 

modality for the follow-up as a baseline for assessment 

of healing. MRI is limited in its ability to fully 

depict the cortical integrity of incomplete fractures in the 

pars interarticularis, but the presence of marrow oedema 

on fat-saturated T2-weighted sequences is a useful sign 

for diagnosing acute spondylolysis 9,10,21 . 

Treatment 

The lack of large controlled clinical trials focused 

on the diagnosis and management of spondylolysis renders 

the establishment of an optimal treatment algorithm 

difficult. Recent advances in imaging technology have 

proven to be useful in the diagnosis and the follow – up 

in symptomatic patients 11 . 

Conservative methods should be applied to all affected 

individuals. In fact, most symptomatic cases do 

well with conservative care. Many pars lesions may 

heal if managed conservatively, particularly those with 

early stage defects. According to the classification 

of Standaert and Herring, pars lesions are divided in 

early, progressive and terminal stages. The likelihood 

to heal is much higher in early stage lesions with very 

few changes of healing or no healing in terminal stages 

9,17,19,22 . 

Pharmacological intervention includes the application 

of pain relief medications. The nonsteroidal anti – inflammatory 

drugs (NSAIDs) should not be ordinarily used because 

they slow down the bone growth and healing. If the 

patient is osteoporotic or osteopenic, alendronate sodium 

is a pharmacological alternative 6,15 . 

Once pain levels are controlled, pulsed ultrasound and 

therapeutic isometric contractions of surrounding musculature 

may be initiated to promote additional blood flow, 

by increasing collagen, neovascular and myofibroblast 

production in the injured lesion. Through this way, the 

healing process is also facilitates. Moreover, the use of 

electrical bone stimulators (internals or externals) seems 

to promote healing 19,23,26 . 

Surgical treatment is used only for symptomatic cases 

were all conservative methods failed to show any effect. 

Approximately 9-15% of cases of symptomatic spondylolysis 

undergo surgery. The main indications include 

intractable pain, progressive slip, development of neurological 

deficits and segmental spine instability. Surgical 

procedures typically attempt a direct repair of the pars 

which is sometimes accompanied by a fusion procedure. 

Specific surgical techniques, such as translaminar screw 

fixation, cerclage wiring loop and pendiculolaminar hook 

screws, preserve segmental motion by repairing the isthmic 

defect 24 . 

Although treating spondylolysis may seem complicated, 

an uneventful outcome may be experienced. Rehabilitation 

programmes are strongly recommended for 

symptomatic and post - surgical patients. It is imperative 

these programmes to be guided by patients’ pain and tol- 

SYRMOU E 

erance and their objectives to be the promotion of bone 

healing, the relief of pain and the optimization of physical 

function 25-27 . 

Conclusions 

It is very important to obtain a prompt diagnosis 

of symptomatic spondylolysis so that the disease can 

be treated properly. The diagnostic approach and the 

treatment of spondylolysis should be carried out on 

an individual basis after taking into consideration the 

patient’s clinical status and the results from the diagnostic 

methods. The management guidelines have 

remained largely unchanged since earlier recommendations. 

Most cases are managed conservatively with 

success. However in special occasions surgery is indicated. 

The introduction of a bone growth stimulator in 

the management of chalenging cases is promising for 

the future of this entity. 

References 

1. Hu SS, Tribus CB, Diab M, Ghanayem AJ. Spondylolisthesis 

and spondylolysis. Instr Course Lect. 2008; 57: 431-445. 

2. McTimoney CA, Micheli LJ. Current evaluation and management 

of spondylolysis and spondylolisthesis. Curr Sports Med 

Rep. 2003; 2: 41-46. 

3. Merbs C. Asymmetrical Spondylolysis. Am J Ph Anthropology. 

2002; 119: 156-174. 

4. Peer KS, Fascione JM. Spondylolysis: a review and treatment 

approach. Orthop Nursing. 2007; 26: 104-111. 

5. Ralston S. Suspecting lumbar spondylolysis in adolescent lumbar 

back pain. Cl Paediatr. 1998; 37: 287-293. 

6. Standaert DC, Herring S. Spondylolysis: a critical review. Br J 

Sports Med. 2000; 34: 415-422. 

7. Rodts MF. Disorders of the spine. Orthop Nurs. 2002; 3: 515- 

550. 

8. Logroscino G, Mazza O, Aulisa AG, Pitta L, Pola E, Aulisa 

L. Spondylolysis and spondylolisthesis in the pediatric and 

adolescent population. Child’s Nerv Syst. 2001; 17: 644- 

655. 

9. Bellaοche L, Petrover D. Imaging in chronic low back pain: 

which one and when? Rev Prat. 2008; 58: 273-278. 

10. Campbell RS, Grainger AJ, Hide IG, Papastefanou S, Greenough 

CG. Juvenile spondylolysis: a comparative analysis of 

CT, SPECT and MRI. Skeletal Radiol. 2005; 34: 63-73. 

11. Wiltse LL, Newman PH, Macnab I. Classification of Spondylolysis 

and Spondylolisthesis. Clin Orthop. 1976; 117: 23-29. 

12. Nance DK, Hickey M. Spondylolisthesis in children and adolescents. 

Orthop Nursing. 1999; 18: 21-27. 

13. Morita T, Ikata T, Katoh S. Pathogenesis of spondylolysis and 

spondylolisthesis in young athletes based on a radiological 

and MRI study. North American Spine Society/Japanese Spine 

Research Society Spine across the Sea meeting, Maui, Hawai; 

1994. 

14. Standaert DC. Practical management: Spondylolysis in the adolescent 

athlete. Cl J Sports Med. 2002; 12: 119-122. 

15. Houglum P. Therapeutic exercise for musculoskeletal injuries. 

Champaign: Human Kinetics; 2005. 

16. Standaert DC, Herring S, Halpern B, King O. Spondylolysis. Ph. 

Med Rehabil Clin North Am. 2000; 11: 785-803. 

17. Jarvik JG, Deyo R. Diagnostic evaluation of low back pain with 

emphasis on imaging. Annals of Internal Medicine. 2002; 137: 

588-598. 

18. Scavone JG, Latshaw RF, Weidner WA. Anteroposterior and lateral 

radiographs: an adequate lumbar spine examination. AJR. 

1980; 136: 715-717.

19. Katoh S, Ikata T, Fujii K. Factors influencing on union of spondylolysis 

in children and adolescents. In: Proceedings and abstracts 

from North American Spine Society meeting, New York; 

1997, pp 222. 

20. Dutton JAE, Hughes SPF, Peters AM. SPECT in the management 

of patients with low back pain and spondylolysis. Cl. Nuclear 

Medicine. 2000; 25: 93-96. 

21. Wirtz DC, Wildberger JE, Röhrig H, Zilkens KW. Early diagnosis 

of isthmic spondylolysis with MRI. Z Orthop Ihre Grenzgeb. 

1999; 137: 508-511. 

22. Dunn AJ, Campbell RS, Mayor PE, Rees D. Radiological findings 

and healing patterns of incomplete stress fractures of the 

pars interarticularis. Skeletal Radiol. 2008; 37: 443-450. 


23. Morita T, Ikata T, Katoh S. Lumbar spondylolysis in children 

and adolescents. J Bone Joint Surg (Br). 1995; 77: 620-625. 

24. Starkey C, Ryan J. Evaluation of Orthopaedic and athletic injuries. 

Philadelphia: FA Davis Company; 2002. 

25. Soler T., Calderon C. The prevalence of spondylolysis in the 

Spanish elite athletes. Am J Sports Med. 2000; 28: 57-62. 

26. Sys J, Michielsen J, Bracke P, Martens M, Verstreken J. Nonoperative 

treatment of active spondylolysis in elite athletes with 

normal X-ray findings: literature review and results of conservative 

treatment. Eur Spine J. 2001; 10: 498-504. 

27. Thein-Nissenbaum J, Boissonault W. Differential diagnosis of 

spondylolysis in a patient with chronic low back pain. J Orthop 

Sports Ph Ther. 2005; 35: 319-326.


PASCHOS KA 

Radiation Synovectomy: an effective alternative treatment for inflamed 

small joints 

Karavida N, Notopoulos A 


1 st Nuclear Medicine Department, Aristotle University of Thessaloniki, Hippokratio Hospital, Thessaloniki, Greece 

Abstract 

An inflamed painful joint is one of the most common indications for the patient to be referred to a rheumatologist 

or an orthopedician. In relation to the aetiology, the therapeutic approach might be systemic, local or a combination of 

them in some cases, always with the thought of balancing risk with benefit for the patient. In all cases, independently of 

the cause, the goal of therapy is to improve the quality of life through the reduction of pain, improvement of mobility 

and preservation of function. Nuclear Medicine has to offer Radiosynoviorthesis, an effective alternative procedure for 

treating inflamed small joints. Various radionuclides are available for radiosynoviorthesis. Their selection depends on 

the size of the joint to be treated. Small joints are mainly treated with [ 169 Er] erbium under a fluoroscopic or sonographic 

guidance, usually with a simultaneous instillation of a corticoid. Candidates for radiosynoviorthesis should have been 

under a six-month systemic treatment without encouraging results or should have undergone at least one unsuccessful 

intra-articular injection of a long acting glucocorticoid. Since 1973, when [ 169 Er] erbium was firstly suggested as a 

therapeutic agent for radiosynoviorthesis of the finger joints, there has been quite enough experience in its’ application. 

It has been found to be cost effective in providing long term relief of pain and deformity of the inflamed joints in comparison 

to other therapeutic approaches. Additionally, there is no radiation risk and can be performed on an out patient 

basis. Therefore it can stand as an effective alternative procedure for treating early stages of chronic synovitis in RA 

(rheumatoid arthritis) patients, with minor damage of the cartilage and the adjacent bones, and for synovitis secondary 

to inflammatory arthropathies. Hippokratia 2010; 14 (1): 22-27 

Key words: radiosynoviorthesis, inflamed small joints 

Corresponding author: Karavida N, 41 Chilis Str. 55132, Thessaloniki, Greece, Tel: +302310486663, Fax: +302310486712, e-mail: niovi@ 

freemail.gr 

A painful joint may appear as a musculosceletal presentation 

of a systemic disease, or as a local degenerative 

procedure. Small joints’ arthritis concerns mainly the 

peripheral joints of hand and foot. It appears usually as a 

result of degenerative diseases such as osteoarthritis, of 

rheumatologic diseases such as rheumatoid arthritis, SLE 

or scleroderma, of diseases characterized by crystal deposition 

such as gout, of autoimmune diseases such as psoriatic 

arthritis and might also be of traumatic aetiology1. 

Therefore, in relation to the aetiology, the therapeutic approach 

might be systemic, local or a combination of them 

in some cases, always with the thought of balancing risk 

with benefit for the patient. 

While feet are mostly affected by a degenerative joint 

disease, through an imbalance between stress bearing 

capacity and actual stress (occupational or sport overuse 

of the joints, overweight, posttraumatic axial deviation, 

ligamentous instability) 2 , hands seem to be present 

many different joint involvement patterns, characteristic 

of specific diseases. For example, in rheumatoid arthritis 

3 the metacarpophalangeal (MCP) and the proximal 

interphalangeal (PIP) joints are most frequently, symmetrically 

affected, whereas, in psoriatic arthritis 4 there 

is an asymmetrical ipsilateral involvement of the joints 

of the fingers, which look like sausages, or a transverse 

involvement of the distal interphalangeal (DIP) joints. 

Furthermore, in finger polyarthrosis 2 the DIP joints (Heberden’s 

polyarthrosis) and/or the PIP joints (Bouchard’s 

polyarthrosis) and/or the first carpometacarpal joint (rhizarthrosis) 

are affected. 

In all cases, independently of the cause, the goal of 

therapy is to improve the quality of life through reduction 

of pain, improvement of mobility and preservation 

of function. The usual treatment programms 5 consist of 

medication, radiopharmaceutic or surgical intervention, 

rehabilitation, patient instruction, psycological support 

and social advice. Given the potential toxicity of the 

systemic therapy (disease modifying drugs, immunosuppressive 

drugs, corticosteroids, nonsteroidal anti-inflammatory 

drugs), local joint therapy 6 (intraarticular corticosteroid 

injection, radiosynoviorthesis, chemosynovectomy 

7 , surgical treatment) is becoming an increasingly attractive 

option. Surgical measures cost a lot of effort and 

financial expenses and have mainly disappointing results 

at finger joints 2 (eg. Swanson endoprosthesis as replacement 

for the PIP joints, arthrodesis with Kirschner wires

of the DIP joints). On the other hand, radiosynoviorthesis 

has a favourable cost to benefit ratio, due to its’ low rate 

of side effects, its’ availability as an outpatient procedure 

and its’ application to all joints, especially to the small, 

peripheral ones 8 . 

Principles of Radiosynoviorthesis 

Radiosynoviorthesis 9 (RSO) is the restoration (orthesis) 

of the synovia by the local application of radioactive 

agents (radiolabelled particulates and radionuclideloaded 

colloid particles), which emit beta rays. In the 

different types of arthritides, as well as in the activated 

arthrosis (osteoarthritis), the main cause of pain and discomfort 

is the underlying synovitis. Therefore, through 

radiosynoviorthesis one tries to influence the synovial 

process favorably as an alternative to early surgical 

synovectomy, especially when a surgical approach is 

contraindicated 10 . 

The injection of the radiopharmaceutical into the 

joint cavity is followed by phagocytosis 11 of it’s’ molecules 

by the outermost cellular layer of the synovial 

membrane (Figure 1A). Due to this selective irradiation, 

the result is apoptosis and ablation of the inflamed synovial 

membrane. A reduction in the number and the size 

of the synovial villi is observed and a decrease of the 

involved hyperaemia (thrombotic occlusion of capillaries) 

as well. 

There is also a reduction in the filtration and reabsorption 

of the synovial fluid. After a few months the synovial 

membrane is fibrosed without signs of mononuclear infiltration 

(Figure 1B). In this way, further destruction of the 

joint cavity by immunological reactions is prevented and 

a long term remission is achieved 12 . 

Table 1: Groups for RSO 14 . 

Group Clinical response 

rate 

A (Appropriate) > 80% Rheumatoid arthritis 

Haemarthrosis in haemophilia 

Haemarthrosis in Willebrand’s disease 

Villonodular synovitis 

B (Acceptable) 60%-80% Rheumatoid arthritis 

Seronegative arthritis 

Osteoarthritis 

Repeating injection in previous 

responder 

C (Helpful) < 60% Rheumatoid arthritis 

Osteoarthritis 

D (Not indicated) No response Need for surgical interventions 

Previous non-responder 

Deformed joints 

Unstable joints 


Figure 1: Mechanism of Action of RSO 

(A) ί-Emitting colloidal particles (yellow stars) phagocytized 

by inflamed hypertrophic synovial lining with proliferating 

synoviocytes (pink). Top cartilage layer remains unaffected. 

(B) Subsequent cell damage and sclerosis of synovial membrane 

Indications 

According to the guidelines of the European Association 

of Nuclear Medicine, candidates 9 for radiosynoviorthesis 

should have been under a six-month systemic 

treatment without encouraging results or should have 

undergone at least one unsuccessful intra-articular injection 

of a long acting glucocorticoid. The earlier in the 

course of the disease 14 , the better results are expected 

from the application of the procedure (Table 1). Among 

common indications for RSO stand rheumatoid arthritis, 

spondyloarthropathy (reactive or psoriatic arthritis), 

hemarthrosis or synovitis in the hemophiliac, chronic 

pyrophosphate arthropathy, pigmented villonodular synovitis, 

persistent effusion after joint prosthesis, osteoarthritis 

(with mild or moderate radiographic changes) 

and inflammatory joint diseases such as Lyme disease or 

Behcet’s disease 15 . 

Disease Pre-existing morphological changes 

No changes 

Steinbrocker I, II 

Minimal or moderate 

Steinbrocker III, IV 

Severe destruction

Table 2: Steinbrocker functional classification of arthritis 18 . 

Contraindications 

The procedure should not be used 9 in case of pregnancy, 

breastfeeding, ruptured baker’s cyst (concerning the 

knee joint) or local skin infection. It should be applied in 

children and young patients (‹20 years) only if the benefit 

of treatment is likely to outweigh the potential hazards. 

Extensive joint instability and osteoarthritis with severe 

joint destruction are relatively contraindicated. 

Radiopharmaceutical selection for RSO 

of the small joints 

Various radiopharmaceuticals are available for radiosynoviorthesis, 

in a colloidal or particulate form. The 

most commonly used worldwide are [ 90 Y] ytrium silicate/ 

citrate colloid, [ 186 Re] rhenium sulfur colloid, [ 169 Er] erbium 

citrate colloid and [ 32 P] chromic phosphate. Their 

selection depends on the physical half live of the radionuclide, 

the mean tissue penetrance of the emitted b-particles, 

the size of the particles in use, their biodegradability 

and irreversible binding of the radionuclide to them, as 

well as the size of the joint to be treated. The smaller the 

joint, the shorter the range of the emitted beta particles 

should be. Besides, the thickness of the synovium and the 

amount of the synovial fluid affect radiation delivery 16 . 

For radiosynoviorthesis of the small joints 2,9 as the MCP, 

PIP and metatarsophalangeal (MTP), [ 169 Er] erbium citrate 

colloid is used. Other joints, that can be treated with 

[ 169 Er] erbium as well, are DIP, tarsometatarsal (TMT), 

the proximal tibiofibular joint and the thumb base joint or 

first carpometacarpal (CMC I). 

[ 169 Er] erbium decays under emission of beta particles 

17 to stable [ 169 Tm] thulium. It has a physical half life 

of 9.5 days and the maximum energy of the b particles 

is 0.34 MeV. The maximum range in soft tissue is 1mm, 

whereas the mean range lies between 0.2 and 0.3mm. 

The fraction of gamma rays is negligible; therefore a 

distribution posttherapeutic scintigraphy is not possible. 

The administered activity and the injected volume vary 

according to the volume of the joint to be treated. Usual 

applications 9 consist of 20-40 MBq in 1ml for MCP 

joints, 30-40 MBq in 1ml for MTP joints and 15-20 

MBq in 0.5 ml for PIP and DIP joints. As many joints 

can be treated at the same session, the total activity of 

erbium injected should not exceed 750 MBq at a single 

session. 

KARAVIDA N 

Class I Complete functional capacity with ability to carry on all usual duties without handicaps. 

Class II Functional capacity adequate to conduct normal activities despite handicap of discomfort or limited mobility 

of one or more joints. 

Class III Functional capacity adequate to perform only few or none of the duties of usual occupation or of self-care. 

Class IV Largely or wholly incapacitated with patient bedridden or confined to wheelchair, permitting little or no selfcare. 

Pretreatment evaluation 

Before proceeding to a radiosynoviorthesis, careful history 

and physical examination are of fundamental importance. 

X-ray films or magnetic resonance imaging of the 

affected joints, ultrasound and scintigraphy are also necessary 

to obtain optimal results 2 . In evaluating the patient the 

clinical stage classification and the functional classification 

of rheumatoid arthritis according to Steinbrocker et al 18 has 

proved to be useful (Table 2). However, an increasing preference 

of the radiologic stage classification according to 

Larsen 19,20 has been observed within recent years, not only 

for rheumatoid arthritis, but also for psoriatic arthritis and 

Behcet’s disease with peripheral joint involvement (Table 

3). Although x-ray examination is an indespensible diagnostic 

tool, the most decisive examination for the detection 

of arthritis is the joint soft tissue scintigraphy 21 . 

This is the second phase of the triple phase bone scintigraphy; 

in which joint images are produced approximately 

5-10 minutes post injection. 

The images represent the distribution in the blood 

pool and the soft tissues. Only with the proof of a clear 

synovitis through scintigraphy does radiosynoviorthesis 

seem promising and therefore indicated. As for sonography 

22 , it helps the physician evaluate the structure and 

the thickness of the synovial membrane (Figure 2). Especially, 

in hands and feet tenovaginitis and tenosynovitis 

are differentiated easily this way. 

Technique 

At every joint there are usually various puncture sites 

available. To avoid an injury of the related structures (vessels, 

nerves, tendons, tendon sheaths) or an extra artricular 

administration, it is advisable to proceed under a fluroscopic 

or sonographic guidance 2,9 . Injection into a joint 

must be performed under sterile conditions, after application 

of local skin anesthesia. The position of the needle 

in smaller joints may easily be controlled by radiography 

under fluoroscopic guidance, using a 22-gauge needle. A 

joint should be punctured with one single plunge through 

the joint capsule, without searching around with the needle 

2,24 . Administration of just enough contrast medium to 

document that the needle is intraarticular is helpful. 

The volume of the injected contrast agent should be as 

small as possible 25 , because the stabilizing agent of ethylenediaminetetraacetic 

acid (EDTA), that it includes, causes

Table 3: Larsen radiologic stage classification of arthritis 19 . 

Grade 0 Normal conditions. Changes not related to arthritis, may be present. 

destabilization of the radiopharmaceutical. Simultaneously 

with the radiopharmaceutical a glucocorticosteroid is 

administered 26,27 , in order to bridge the lag phase between 

the time of the injection and the time of the effect of RS, 

to lower the risk of radiation-induced synovitis and to inhibit 

a possible extraarticular leakage of the radiopharmaceutical. 

Triamcinolone 26 is often used at a dosage of 8mg 

(0,2ml) for MCP and 4mg (0,1ml) for PIP joints. What 

seems of great significance is the fact that overpressure 

during administration should be avoided. For this reason 

a dose of small volume and high specific activity is preffered 

2 . Sometimes, due to the synovial hypertrophy and the 

joint space narrowing, there is hardly any inner space for 

the administration of the radiopharmaceutical. 

Then, it is preferable to inject a few drops of the 

activity (followed by air) and proceed to a re-radiosynoviorthesis 

a few months later 2 . Before removal of the 

needle, flushing with saline solution is recommended to 

keep the puncture channel free of beta emitting particles. 

After removing the needle, the puncture site is squeezed 

off with a gauze, fixed with an elastic bandage and the 

joint, under manual pressure upon the puncture site, is 

carefully moved a couple of times. 

Then a splint or a cast is formed to the physiologic 

position of the joint and the joint is immobilized for 48- 

72 hours 2,9,26 . The treated joint should be at a state of mild 

relaxation for approximately 1 week. When toe joints are 

treated, the patient leaves on a wheelchair and is advised 

to walk only to the restroom for the aforementioned period 

of time 28 . 

After RSO 

The patient should be urged to report by telephone 

about 4-6 days after the radiosynoviorthesis for possible 

side effects. After this period, a follow-up visit at 

3-4 months, 6 months and 1 year post therapy is recom- 


Grade I Slight abnormality. One or more of the following changes are present: periarticular soft tissue swelling, 

periarticular osteoporosis and slight joint space narrowing. When possible, use for comparison a normal 

contralateral or a previous radiograph of the joint in the same patient sa grade 0, as demonstrated in standard 

films. Soft tissue swelling and osteoporosis are sometimes reversible changes. This is an early, uncertain 

phase of arthritis. The compatible changes may occur without arthritis in old age, in traumatic conditions or 

in Sudeck’s atrophy. 

Grade II Definitive early abnormality. Erosions and joint space narrowing corresponding to the standards. Erosion is 

obligatory except in the weight-bearing joints (in standard films erosion is present in all joints except tarsus). 

Grade III Medium destructive abnormality. Erosion and joint space narrowing corresponding to the standards. 

Grade IV Severe destructive abnormality. Erosion and joint space narrowing corresponding to the standard. Bone 

deformation is present in the weight-bearing joints. 

Grade V Mutilating abnormality. The original articular surfaces have disappeared. Gross bone deformation is present 

in the weight-bearing joints. 

mended 2,9,12 . Pain reduction typically occurs 1-3 weeks 

post injection, but occassionally may delay a couple of 

weeks more . Patients should be informed 9 that the procedure 

is 60%-80% effective and that there is the possibility 

of a temporary increase in synovitis. Active training of 

the periarticular soft tissue apparatus is recommended in 

order to achieve the maximum functional capacity of the 

joint 28 . A tingling sensation or stabbing pain in the joint 

might appear, for which a cold compress or ice directly 

to the joint and not through the bandage could be applied. 

Potential complications 9,29 of treatment are local haemorrhage, 

bruising, extravasation and radiation necrosis, and 

very rarely infection or allergic reaction. Thrombosis due 

to immobilization and lymphoedema may occur. Since 

the radionuclide is applied in form of a colloid of appropriate 

size, it remains mostly within the joint, with no 

significant radiation exposure to other organs or parts of 

the body. The risk for induction of a future malignancy is 

estimated as exceptionally small 30-33 . Patients who have 

failed to respond to the first radionuclide injection report 

pain reduction and improvement of joint function follow- 

Figure 2: Woman 60 years old, with soft tissue swelling and 

RA test (+) 

Synovitis and bone erosions of the PIP II 23

Table 4: Comparison of isotope properties 17 . 

Isotope Particle size 

(μm) 

ing re-treatment 6 months later. The simultaneous instillation 

of a corticoid often brings permanent recovery in 

contrast to steroidal ineffectiveness before radiosynoviorthesis 

12,34 . 

Clinical effect 

Since 1973, when [ 169 Er] erbium was firstly suggested 

as a therapeutical agent for radiosynoviorthesis of the finger 

joints 35 , there has been quite enough experience in its’ 

application. Although there is no uniform, validated system 

for scoring the effect of RSO, which makes comparison 

between different studies difficult, reported success 

rates range from 40% to 95% for the different joints and 

underlying pathology 2,12 . At the early years of RSO, good 

to very good results leading to restoration of normal function 

have been reported in 54% 6 months after treatment 

in a study consisting of 1261 finger joints by Menkes et 

al 36 , as well as in a study by Rampon et al 37 . Boussina et al 

reported good to excellent results concerning pain relief 

and joint mobility in 71.5% and 79.4% 6 months and 12 

months after RSO, respectively 38 . At that time, another 

study by Tubiana et al. reported 62.5% good and very 

good results 1 year post RSO treatment of MCP and PIP 

joints 39 . In later years, Gamp found good and satisfactory 

results 6 months after RSO in 70% of MCP joints and 

54% of PIP joints. 

These results were noticed in 68% of both MCP and 

PIP joints 1 year after treatment and 64% and 41% respectively 

at 2 years follow-up 40 . More recently, according 

to a double-blind, randomized, placebo-controlled, 

international multicentre study in patients with RA and 

recent (≤24 months) ineffective corticosteroid injections 

into their finger joints, there has been reported, a six 

months follow-up with a 92% decrease in pain, a 82% 

decrease in swelling and a 64% increase in mobility of 

the MCP and PIP treated joints in comparison to the placebo-injected 

joints, which showed 72%, 53% and 42% 

respectively 41 . Best results come from a study of Mödder 

et al, who report 95% good results, concerning pain 

relief and 83% total improvement, concerning joint mobility 

and swelling, in patients with rheumatoid arthritis 

and corticosteroid resistant small joints (MCP, PIP, DIP, 

MTP) six months post therapy 2 . 

These relatively good results are attributable to optimal 

injection parameters such as high specific activity, 

small injection volume and fluoroscopic control 2 . In 

overall, after the application of RSO, a reduction of pain, 

swelling and stiffness of the joint is observed, as well as 

KARAVIDA N 

Emission Halph-life 

(days) 

Soft tissue penetration 

mean/max (mm) 

169-Erbium 2-3 beta 9.5 0.30 / 1.0 

177-Lutetium 2-10 beta, gamma 6.73 0.67 / 2.0 

an improvement in the range of movement and quality of 

life 42,43 . The effect rate of the procedure is estimated at 

about 79% for the upper and 60% for the lower extremities 

at a period of six months 44 . The higher effect rate of 

the upper extremities, which is in accordance with another 

randomized, double-blind, placebo-controlled study of 

the upper extremity joints 45 , is attributed to the absence of 

weight-bearing mechanical forces in them. A less favorable 

outcome for RS has been reported in more severely 

damaged joints and in diseases other than RA, especially 

osteoarthritis 13,43,46 . 

According to a survey 47 undertaken by PJ Ell and G 

Clunie, radiosynoviorthesis is practiced in about 24% of 

nuclear medicine centres in Europe. Rheumatoid arthritis 

is the most prevalent disease (71% of treated patients) 

and the most frequently treated joints are knee (46%) and 

finger joints (20%). Corticosteroid is routinely co-injected 

in 60% of cases. 

Conclusion 

With a 35 year record of use, radiosynovectomy of 

the small joints is an effective alternative procedure for 

treating early stages of chronic synovitis in RA patients, 

with minor damage of the cartilage and the adjacent 

bones, and for synovitis secondary to inflammatory arthropathies 

9,13,48 . It has been found to be cost effective 

in providing long term relief of pain and deformity of 

the inflamed joints in comparison to other therapeutical 

approaches 12,49,50 . Additionally, there is no radiation 

risk and can be performed on an out patient basis 9 . As 

for the future prospects of the technique, Lutetium-177 

( 177 Lu) labeled hydroxyapatite particles 51 (Table 4) are 

considered a promising radiopharmaceutical in radiation 

synovectomy of small-sized joints, owing to its favorable 

decay characteristics and feasible and cost-effective 

production route in comparison to Erbium. Nevertheless, 

further investigations are yet to come. 

References 

1. Heisel J. Entzuendliche Gelenkerkrankungen. Stuttgart: Verlag; 

1992. 

2. Mödder G. Radiosynoviorthesis. Involvement of Nuclear Medicine 

in Rheumatology and Orthopaedics. Warlich Druck und 

Verlagsgesellschaft mbh 2001. 

3. The American Rheumatism Association revised criteria for the 

classification of rheumatoid arthritis. Arthr Rheum. 1987; 31: 

315-324. 

4. Dihlmann W. Bildgebende Verfahren in der Rheumatologie. Internist. 

1993; 34: 825-830.

5. Miehlke K. Medikamentoese Therapie und Prophylaxe der Arthrose. 

Internist. 1989; 30: 643-645. 

6. Bird HA. Intra-articular and intralesional therapy S8/16.5 in 

Klippel JH, Dieppe PA: Rheumatology. London: Mosby; 1994; 

p. 163-165. 

7. Dahmen G. Possibilities and dangers of chemical synovectomy. 

Hippok. 1971; 42: 251-252. 

8. Gamp R. Die Radiosynoviorthese im Handbereich. Akt Rheumatol. 

1983; 8: 165-167. 

9. Clunie G, Fischer M. EANM procedure guidelines for radiosynovectomy. 

Eur J Nucl Med Mol Imaging. 2003; 30: BP12- 

BP16. 

10. Dunn AL, Busch MT, Wyly JB, Abshire TC. Radionuclide synovectomy 

for hemophilic arthropathy: a comprehensive review of 

safety and efficacy and recommendation for a standardized treatment 

protocol. Thromb Haemost. 2002; 87: 383-393. 

11. Valotassiou V, Wozniak G, Demakopoulos N, Georgoulias P. 

Radiosynoviorthesis-indications, side effects. Hell J Nucl Med. 

2006; 9: 187-188. 

12. Pirich C, Schwameis E, Bernecker P, et al. Influence of radiation 

synovectomy on articular cartilage, synovial thichness and 

enhancement as evidenced by MRI in patients with chronic synovitis. 

J Nucl Med. 1999; 48: 1277-1284. 

13. Schneider P, Farahati J, Reiners C. Radiosynovectomy in rheumatology, 

orthopedics, and hemophilia. J Nucl Med. 2005; 46: 

48s-54s. 

14. Kresnik E, Mikosch P, Gallowitsch HJ. Clinical outcome of radiosynoviorthesis: 

a meta-analysis including 2190 treated joints. 

Nucl Med Comm. 2002; 23: 683-688. 

15. Siegel HJ, Luck VJ Jr, Siegel ME. Advances in radionuclide 

therapeutics in orthopaedics. J Am Acad Orthop Surg. 2004; 12: 

55-64. 

16. Farahati J, Schulz G, Wendler J. Multivariate analysis of factors 

influencing the effect of radiosynovectomy. Nuklearmedizin. 

2002; 41: 114-119. 

17. Cherry S, Sorenson J, Phelps M. Physics in Nuclear Medicine 3 rd 

ed. Philadelphia: Saunders; 2003; p.20-21. 

18. Steinbrocker O, Traeger CH, Batterman RC. Therapeutic criteria 

in rheumatoid arthritis. J Am Med Ass. 1949; 140: 659-663. 

19. Larsen A. A radiological method for grading the severity of 

rheumatoid arthritis. Helsinski: Thesis; 1974. 

20. Dale K, Eek M. Preliminary experiences with Larsen’s radiological 

method for grading rheumatoid arthritis. Scand J Rheumatol. 

1975; 4/8 abstr. 27-02. 

21. Ziessman H, O’Malley J, Thrall J. The Requisites. Nuclear Medicine 

3 rd ed. Philadelphia: Mosby Elsevier; 2006; p.115-116. 

22. Sattler H, Harland U. Arthrosonographie. Berlin-Heidelberg: 

Springer-Verlag; 1988. 

23. Raphailidis D. Ultrasound of the musculosceletal system and 

soft tissues. Rotonda; 2006. 

24. Kaiser H, Fischer W. Technicken der Injektion. Selecta-Verlag; 

1985. 

25. Schomäcker K, Dietlein M, Mödder G, et al. Stability of radioactive 

colloids for radiation synovectomy: influence of X-ray 

contrast agents, anaesthetics and glucocorticoids in vitro. Nucl 

Med Comm. 2005; 26: 1027-1035. 

26. van der Zant FM, Jahangier ZN, Gommans GM. Radiation synovectomy 

of the upper extremity joints: does leakage from the 

joint to non-target organs impair its therapeutic effect? Appl Rad 

Isotopes. 2007; 65: 649-655. 

27. Noble J, Jones AG, Davis MA. Leakage of radioactive particle 

systems from a synovial joint studied with a gamma camera: its 

application to radiation synovectomy. J Bone Joint Surg. 1983; 

65: 381-389. 

28. Mόller-Brand J. Grundlagen der Radiosynoviorthese. Schweiz 

Med Wochenschr. 1990; 120: 676-679. 

29. Das BK. Role of radiosynovectomy in the treatment of rheu- 


matoid arthritis and hemophilic arthropathies. Biomed Imaging 

Interv J. 2007; 3: 45. 

30. Lόders C, Kopec M, Morstin K. Die Radiosynoviorthese. Anwendung 

und Durchfuehrung unter besonderer Beruecksichtigung 

dosimetrischer Aspekte. Akt Rheum. 1992; 17: 74-81. 

31. Johnson LS, Yanch JC, Shortkoff CL, Barnes AI, Sledge CB. 

Beta-particle dosimetry in radiation synovectomy. Eur J Nucl 

Med. 1995; 22: 977-988. 

32. Liepe K, Andreeff M, Mielcarek J. Beta radiation exposure at 

the finger tips during the radionuclide synovectomy. J Nucl Med. 

2003; 42: 104-108. 

33. Johnson LS, Yanch JC. Calculation of beta dosimetry in radiation 

synovectomy using Monte Carlo simulation (EGS4). Med 

Phys. 1993; 20: 747-753. 

34. Fischer M, Mödder G. Radionuclide therapy of inflammatory 

joint diseases. Nucl Med Commun. 2002; 23: 829-831. 

35. Delbarre F, Menkes CJ, Aignau M. La synoviorthese par les 

radioisotopes a la main et au poignet. Rev Rheum. 1973; 40: 

205. 

36. Menkes CJ, Verrier P, Le Go A. Radio-isotopic synoviorthesis 

of finger joints in rheymatoid arthritis. Ann Chir. 1974; 28: 883- 

889. 

37. Rampon S, Bussiere TZ, Prim P. Synoviorthese par les radioisotopes. 

Rheumatologie. 1976; 6: 123-135. 

38. Boussina I, Toussaint M, Ott H. A double-blind study of erbium 

169 synoviorthesis in rheumatoid digital joints. Results after one 

year. Scand J Rheumatol. 1979; 8: 71-74. 

39. Tubiana R, Menkes CJ, Galmiche B, Delbarre F. Die intraartikulaere 

Injektion von B-Strahlern. Ihre Anwendung zur Behandlung 

der rheumatoiden Veraenderungen an der Hand. Therapiewoche. 

1979; 29: 507-513. 

40. Gamp R. Die radiosynoviorthese im Handbereich. Akt Rheumatol. 

1995; 8: 165-167. 

41. Kahan A, Mödder G, Menkes CJ. 169 Erbium-citrate after 

failure of local corticosteroid injections to treat rheumatoid 

arthritis affected finger joints. Clin Exp Rheumatol. 2004; 22: 

722-726. 

42. Srivastava S, Dadachova E. Recent advances in radionuclide 

therapy. Semin Nucl Med. 2001; 31: 330-341. 

43. Kampen WU, Hellweg L, Massoudi-Nickel S, et al. Clinical efficacy 

of radiation synovectomy in digital joint osteoarthritis. Eur 

J Nucl Med Mol Imaging. 2005; 32: 575-580. 

44. Jahangier ZN, Moolenburgh JD. The effect of radiation synovectomy 

in patients with persistent arthritis: a prospective study. 

Clin Exp Rheumatol. 2001; 19: 417-424. 

45. van der Zant FM, Jahangier ZN, Moolenburgh JD. Clinical effect 

of radiation synovectomy of the upper extremity joints: a 

randomised, double-blind, placebo-controlled study. Eur J Nucl 

Med Mol Imaging. 2007; 34: 212-218. 

46. Deutsch E, Brodack JW, Deutsch KF. Radiation synovectomy 

revisited. Eur J Nucl Med. 1993; 20: 1113-1127. 

47. Clunie G, Ell PJ. A survey of radiation synovectomy in Europe, 

1991-1993. Eur J Nucl Med. 1995; 22: 970-976. 

48. Kat S, Kutz R, Elbracht T, Weseloh G, Kuwert T. Radiosynovectomy 

in pigmented villonodular synovitis. Nuklearmedizin. 

2000; 39: 209-213. 

49. Gobel D, Gratz S, von Rothkirch T. Chronic polyarthritis and 

radiosynoviorthesis: a prospective, controlled study of injection 

therapy with erbium 169 and rhenium 186. Z Rheumatol. 1997; 

56: 207-213. 

50. Kampen WU, Brenner W, Kroeger S. Long-term results of radiation 

synovectomy: a clinical follow-up study. Nucl Med Commun. 

2001; 22: 239-246. 

51. Chakraborty S, Das T, Banerjee S. Preparation and preliminary 

biological evaluation of 177 Lu labelled hydroxyapatite as a 

promising agent for radiation synovectomy of small joints. Nucl 

Med Comm. 2006; 27: 661-668.


PASCHOS KA 

Platelet distribution width: a simple, practical and specific marker 

of activation of coagulation 

Vagdatli E 1 , Gounari E 1 , Lazaridou E 1 , Katsibourlia E 2 , Tsikopoulou F 3 , Labrianou I 4 

ORIGINAL ARTICLE 

1 Department of Medical Laboratory Studies, Technological Educational Institution of Thessaloniki, Greece 

2 Hematology Laboratory, General Hospital of Polygyros, Greece 

3 Medical School, Aristotle University, Thessaloniki, Greece 

4 Hematology Laboratory, General Hospital of Florina, Greece 

Abstract 

Background: Platelet indices are potentially useful markers for the early diagnosis of thromboembolic diseases. An 

increase in both mean platelet volume (MPV) and platelet distribution width (PDW) due to platelet activation, resulting 

from platelet swelling and pseudopodia formation was hypothesized. 

Methods: Platelet indices (MPV and PDW) in three groups of persons, using impedance and optical technology were 

measured. The first group consisted of patients with established platelet activation and healthy control subjects. The 

second study group included pregnant women in different trimesters of pregnancy. The effect of storage time on MPV 

and PDW in blood samples of a third group of randomly chosen patients was also assessed. 

Results: There was a significant increase in MPV (P

in the first trimester of pregnancy, 32 in the second trimester 

and 30 in the third trimester). Samples were analyzed 

by the hematology analyzer GENS (Coulter) two 

hours after blood sampling, 

(c) Thirty five (35) randomly chosen patients. Blood 

samples were analyzed by the hematology analyzer 

GENS (Coulter) one, two, three and four hours after 

blood sampling. 

All blood samples were collected in tubes with potassium 

ethylenediaminetetraacetate (EDTA) as an anticoagulant. 

The following hematological parameters were 

studied in all blood samples: platelet count (PLT), mean 

platelet volume (MPV) and platelet distribution width 

(PDW). Impedance resistance was used for the measurement 

of platelet indices in all blood samples (analyzers 

CELL DYNN 1700 and GENS). Blood samples in group 

(a) were further analyzed by optical method (CELL 

DYNN 3200). 

Data were analysed using SPSS 12 software for Windows. 

Normality of continuous data was determined by 

Kolmogorov-Smirnov or Shapiro-Wilk normality test. 

All continuous data following normal distribution are 

presented as mean (SD, standard deviation). Independent-samples 

were examined with students’ t-test, One- 

Way ANOVA, and paired-samples t-test were used for 

comparisons in group (a), (b) and (c), respectively. A two 

tailed P value

Regarding the indices among women during different 

trimesters of pregnancy, power analysis performed 

showed that for three levels of comparison, with an estimated 

mean for the MPV of 9 and a standard deviation of 

0.16, with 30 participants per group, there is an 99,98% 

possibility to detect a difference of 0.25 among the three 

groups, if that difference exists. As regards PDW, for 

an estimated mean of 16.5 and a standard deviation of 

0.73, with 30 participants per group, there is an 80.00% 

possibility to detect a difference of 0.55 among the three 

groups, if that difference exists. 

MPV increased during storage time in study group 

(c), while PDW decreased over time (Table 3, Figures 3 

and 4). There was a significant increase of MPV in the 

fourth measurement compared to the first (P

Table 4: Comparison of MPV and PDW values measured 

one and four hours after blood sampling. 

Platelet indices 1 st / 4 th hour 

MPV P

tor of platelet activation: methodological issues. Platelets 2002; 

13 (5-6): 301-306. 

14. Tsiara S, Elisaf M, Jagroop IA, Mikhailidis DP. Platelets as predictors 

of vascular risk: is there a practical index of platelet activity? 

Clin Appl Thromb Hemost 2003; 9 (3): 177-190. 

15. Howarth S, Marshall LR, Barr Al et al. Platelet indices during 

normal pregnancy and preeclampsia.Br J Biomed Sci 1999; 56: 

20-22. 

16. von Dadelszen P, Magee LA, Devarakonda RM et al.. The prediction 

of adverse maternal outcomes in preeclampsia. J Obstet 

Gynaecol Can 2004; 26 (10): 871-879. 

17. Furlanello T, Tasca S, Caldin M et al. Artifactual changes in 

canine blood following storage, detected using the ADVIA 

120 hematology analyzer. Vet Clin Pathol 2006; 35 (1): 42- 

46. 

18. Ihara A, Kawamoto T, Matsumoto K, Shouno S, Morimoto T, 

Noma Y. Relationship between hemostatic factors and the plate- 

VAGDATLI E 

let index in patients with ischemic heart disease. Pathophysiol 

Haemost Thromb 2006; 35 (5): 388-391. 

19. Khandekar MM, Khurana AS, Deshmukh SD, Kakrani AL, Katdare 

AD, Inamdar AK. Platelet volume indices in patients with 

coronary artery disease and acute myocardial infarction: an Indian 

scena. J Clin Pathol 2006; 59 (2): 146-149. 

20. Amin MA, Amin AP, Kulkarni HR. Platelet distribution width 

(PDW) is increased in vaso-occlusive crisis in sickle cell disease. 

Ann Hematol 2004; 83 (6): 331-335. 

21. Beyan C, Kaptan K, Ifran A. Platelet count, mean platelet volume, 

platelet distribution width, and plateletcrit do not correlate 

with optical platelet aggregation responses in healthy volunteers. 

J Thromb Thrombolysis 2006; 22 (3): 161-164. 

22. Van Cott EM, Fletcher SR, Kratz A. Effects of the blood-collection 

tube material and long-term storage on platelet activation 

parameters on the ADVIA 120/2120 hematology system. Lab 

Hematol 2005; 11 (1): 71-75.



Respiratory function in amyotrophic lateral sclerosis patients. 

The role of sleep studies 

Tsara V, Serasli E, Steiropoulos S, Tsorova A, Antoniadou M, Zisi P 

2 nd Chest Dept, G. Papanikolaou Hospital, Thessaloniki, Greece 


Abstract 

Background and aim: Respiratory function decline in association with sleep breathing abnormalities in Amyotrophic 

Lateral Sclerosis (ALS) patients are fully recognized as crucial manifestations in the natural course of the disease, severely 

affecting the prognosis. The aim of this study was to evaluate the respiratory function at daytime and during sleep 

in a population of ALS patients and investigate the necessity of sleep study performance for the appropriate management 

of the disease. 

Patients and methods: Twenty eight (10 male, 18 female) unselected patients with ALS, were evaluated in terms with 

their functional status by means of the ALS Functional Scale (ALSFSC). Baseline anthropometric measurements, pulmonary 

function tests and arterial blood gasses analysis were performed, as well as evaluation of patients’ perception of 

dyspnoea. A polysomnography was performed using a multichannel ambulatory recording. 

Results: Nineteen patients had sleep disordered breathing with an RDI (Respiratory Disorder Index)> 5/h (from 5.6/h 

to 83/h) and 10 patients had an RDI>15/h. All patients had impaired functional capacity by the ALSFSC and 11 patients 

(39.3%) reported mild to moderate dyspnoea. FVC was below 80% predictive value in 22 patients and in 8 patients 

hypoxaemia (PaO 2 40mmHg) was present. There was no correlation 

found between spirometric values, maximum inspiratory and expiratory pressures and sleep study parameters. There 

was a significant correlation between PaCO 2 and RDI (r=0.498, p

A polysomnography was performed using the Embletta 

(Flaga) multichannel ambulatory recording, in a 

quiet room during each patients usual sleep time. This 

portable device measured nasal /oral flow with a pressure 

traducer, snoring with a microphone, thoraco-abdominal 

movements and oxygen saturation with a pulse oxymeter, 

and has accuracy equivalent to PSG 7 . Sleep apnoea and 

hypopnoea were defined according the standard criteria: 

Apnea was defined as a complete cessation of air flow 

lasting > 10 s; hypopnea was defined as a discernible fall 

in air flow lasting ≥ 10 s accompanied by a decrease in 

oxygen saturation of at least 3% 8 . 

Statistical analysis 

All data are expressed as mean ± standard deviation 

(M±SD). Descriptive statistics were used and the Spearman’s 

correlation coefficient test was used to explore 

the correlation between variables. Two sample t-test and 

Mann-Whitney test were used for non parametric variables 

between patients with normal and abnormal pulmonary 

tests. Statistical significance was set at p 40mmHg) was 

present. There was no difference between men and women 

in age, in ALSFCS and in pulmonary tests, but women 

expressed more dyspnoea than men (2.7±1.5 and 1.5±0.9 

respectively, p 5/h (from 5.6/h to 83/h) and 10 patients 

had RDI > 15/h. The average SpO 2 before sleep onset 

was greater or equal to 90% in all patients. Reduction in 

SpO 2 during sleep was present in all patients (range of 

minimum SpO 2 : 61% to 90%) and the index of desaturation 

events (ODI) ranged from 2 to 102/h. Fifteen patients 

spent more than 5% of recorded period with SpO 2 

Table 1: Anthropometric characteristics and pulmonary function tests results in the study group. 

*p

90% (30.1± 29.6%) with a minSaO 2 88%. Three of the 

patients with RDI

esults we speculate that the performance of daily pulmonary 

function tests alone is not enough to detect respiratory 

dysfunction during sleep in ALS patients. These 

results are in agreement with others, who suggested that 

sleep study in ALS patients is a valuable screening test 

for the early diagnosis of SDB and moreover for the early 

use of non invasive ventilation16 . 

A possible limitation of our study was the absence of 

an EEG to confirm sleep structure disturbances and also 

to examine in detail the observed hypoxaemia, which 

was not associated with apneas/hypopneas. The portable 

device we used has as a high accuracy as standard polysomnography7 

and also gives more information of sleep 

breathing than simple overnight oximerty. We suggest 

that the use of portable devices in daily routine facilitate 

the early detection of SDB, which is essential for the appropriate 

management of respiratory dysfunction in these 

patients. 

In conclusion, sleep-breathing abnormality is common 

in ALS patients in the absence of documented respiratory 

failure. In our study the daytime function in 

ALS patients did not reflect the breathing during sleep, 

supporting the view that clinical evaluation and respiratory 

function tests alone may not be sufficient to predict 

SDB and nocturnal breathing assessment should also be 

performed 

Conflict of interest: none. 

References 

1. Schiffman PL, Belsh JM. Pulmonary function at diagnosis of 

amyotrophic lateral sclerosis. Rate of deterioration. Chest. 1993; 

103: 508-513. 

2. Vitacca M, Clini E, Facchetti D, Pagani M, Poloni M, Porta R, 

Ambrosino N. Breathing pattern and respiratory mechanics in 

patients with amyotrophic lateral sclerosis. ERJ. 1997; 10: 1614- 

1621. 

3. Ferguson KA, Strong MJ, Alimand D, George CFP: Sleep-disordered 

breathing in Amyotrophic Lateral Sclerosis. Chest. 1996; 

110: 664-669. 

TSARA V 

4. Davis WS, Bundie SR, Mahdavi Z. Polysomnographic studies 

in amyotrophic lateral sclerosis. Journal of Neurol Scin. 1997; 

Sup 152: S29-S35. 

5. Kimura K, Tachibana N, Kimura J, Shibasaki H. Sleep disordered 

breathing at an early stage of amyotrophic lateral sclerosis. 

Journal of the Neurological Sciences. 1999; 164: 37-43. 

6. The ALS CNTF Treatment Study (ACTS) Phase II Study Group. 

Amyotrophic Lateral Sclerosis Functional Rating Scale assessment 

of activities of daily living in patients with amyotrophic 

lateral sclerosis. Arch Neurol. 1996; 53: 141-147 

7. Dingli K, Coleman EL, Finch SP, Wraith PK, Mackay TW, 

Douglas NJ. Evaluation of a portable device for diagnosing the 

sleep apnea/hypopnea syndrome. ERJ. 2003; 21: 253-259. 

8. American Academy of Sleep Medicine (AASM). Sleep related 

breathing disorders in adults: recommendations for syndrome 

definition and measurement techniques in clinical research. 

Sleep. 1999; 22: 667-689. 

9. Lyall RA, Donaldson N, Leight PN, Moxham J: Respiratory 

muscle strength and ventilatory failure in amyotrophic lateral 

sclerosis. Brain. 2001; 124: 2000-2013. 

10. Polkey MI,Lyall RA, Green M, Leigh NP, Moxham J. Expiratory 

muscle function in Amyotrophic Lateral Sclerosis. AJRCCM. 

1998; 158: 734-741. 

11. Similowski T, Attali V, Bensimo G, Salachas F, Mehiri S, Amulf 

I, et al. Diaphagmatic dysfunction and dyspnea in amyotrophic 

lateral sclerosis. ERJ. 2000; 15: 332-337. 

12. Arnulf I, Similowski T, Salachas F, Garma L, Mehiri S, Attali 

V, et al. Sleep disorders and diaphragmatic function in patients 

with amyotrophic lateral sclerosis. Am J Resir Crit Care Med. 

2000; 161: 849-856. 

13. Bourke SC, Shaw PJ, Gibson GJ. Respiratory function vs sleep 

disordered breathing as predictors of QOL in ALS. Neurology 

2001; 57: 2040-2044. 

14. Atalaia A, De Carvalho M, Eyangelista T, Pinto A. Sleep characteristics 

of amyotrophic lateral sclerosis in patients with preserved 

diaphragmatic function. Amyotrophic Lateral Sclerosis. 

2007; 8: 101-105. 

15. Santos C, Brachiroli A, Mazzini L, Pratesi R,Franco Oliviera LV, 

et al.. Sleep-related breathing disorders in amyotrophic lateral 

sclerosis. Monaldi Arch Chest Dis. 2003; 2: 160-165. 

16. Pinto A, de Carvalho M, Evangelista T, Lopes A, Sales-Luis L. 

Nocturnal pulse oximetry:a new approach to establish the appropriate 

time for non-invasive ventilation in ALS patients. ALS 

and Other Motor Neuron Disorders. 2003; 4: 31-35.




Sciatic nerve crush evokes a biphasic TGF-β and Decorin modulation in the rat 

spinal cord 

Kritis A 1 , Kapoukranidou D 1 , Michailidou B 2 , Hatzisotiriou A 1 , Albani M 1 

1 Laboratory of Physiology, Department of Physiology and Pharmacology, Medical School, Aristotle University of Thessaloniki, 

Greece 

2 nd 2 Department of Neurology, AHEPA University Hospital, Aristotle University, Thessaloniki, Greece 

Abstract 

Background and aim: Inherent property of the motoneurons of the peripheral nervous system is their ability to recover, 

at least in part, upon injury. To this end different factors are expressed and are thought to play important role in the regeneration 

processes. These factors are diverse, and range from transcription factors and chemokines, to molecules of the 

extracellular matrix. Transforming growth factor beta (TGF-β) is a protein with diverse actions controlling cell growth 

and proliferation. In the extracellular matrix it is found bound to decorin a proteoglycan involved in cell adhesion and 

cell signaling. In the present study we investigate the expression of TGF-β and decorin at different time points, in the 

regenerating sciatic nerve of a seven day old rat, having suffered nerve crush injury, over a period of one month. 

Materials and methods: To achieve this, we evoked injury to male Wistar rats by exposing and applying pressure to 

the sciatic nerve using watchmaker’s forceps. After that at 12h, 24h, 48h, 72h, one week, and one month intervals we 

investigated the gene expression of decorin using RT-PCR, and followed the expression of TGF-β molecule by immunohistochemistry 

in frozen sections of the L4-L5 region of the rat spinal cord. 

Results: We report that both decorin mRNA and TGF-β protein exhibit a concerted, biphasic expression after 12 hours 

and one month having the animal suffered the nerve crush. 

Discussion: Our data reveal a biphasic modulation of TGF-β protein and decorin mRNA expression at lumbar segment 

of the spinal cord of animals having suffered unilateral sciatic nerve crush. We postulate that their concerted expression 

both at an early and a late phase after the nerve injury is of importance and can be part of a repair or neuroprotective 

mechanism as yet unclarified. Hippokratia 2010; 14 (1): 37-41 

Key words: TGF-beta, decorin, nerve crush, sciatic nerve, neurodegeneration 

Corresponding author: Kritis A, Laboratory of Physiology, Medical School, Aristotle University, Thessaloniki, Greece, e-mail: kritis@med. 

auth.gr 

Peripheral nerve injury elicits a complex response 

pertaining to both nerve degeneration and repair through 

mechanisms that are not fully understood yet. In neonatal 

rats the survival and development of motoneurons is 

dependent upon the functional interaction with their target 

muscles. Peripheral nerve injury during this period 

causeds degeneration and loss of motoneurons 1,2 . In contrast 

to the central nervous system, mature neurons of the 

peripheral nervous system are able to survive and regenerate 

after injury. To this end different molecules such 

as cytokines and neurotrophins as well as molecules of 

the extracellular matrix are expressed and are thought to 

be part of a repair mechanism or act against nerve repair 

and axon regeneration 3-7 . The processes seem to be well 

coordinated since both the receptors for these molecules 

as well as their corresponding intracellular effectors’ expression 

is modulated 4,8,9 . A central role to regulate the 

repair process was assigned to members of the TGF-β superfamily 

including TGF-β, activin and BMP which are 

all expressed by injured motoneurons 4,10-12 . In mammals 

TGF-β can be found in three isoforms TGF-β1, TGF-β2, 

and TGF-β3 which are highly conserved among species 13 . 

TGF-β is a pleiotropic cytokine synthesized in a latent 

form which upon activation exerts its functions as a homodimer 

through three classes of receptors ΤβRI, TβRII 

and TβRIII found in most cell types 14 . Receptor activation 

is achieved when TGF-β binds to TβRII which then forms 

a heterodimer with TβRI which in turn is phosphorylated 

by the constitutively active kinase domain of TβRII. 

Thus, the molecular switch is set to “ON” and downstream 

signaling is initiated. The activated TβRI then interacts 

with the Smad proteins which in turn are classified 

into three classes depending on their structure and function. 

R-Smads are directly phosphorylated and activated 

by the activated TβRI, co-Smad (common partner) is 

Smad-4 and I-Smads exert inhibitory function competing 

with R-Smads for the activated TβRI receptor. Smads 

are then transferred to the nucleus were they interact with 

other signalling proteins to modulate the transcription of 

certain target genes 15-17 . In the extracellular matrix, TGFβ 

can be bound to biglycan, decorin, fibromodulin and 

betaglycan the later being a synonym for TRβIII. This

association of TGF-β with the proteins of the extracellular 

matrix and specifically with decorin attenuates its 

function by generating an extracellular reservoir for the 

factor, or enhances its activity by helping to present TGFβ 

to its receptors or even activates alternative TGF-β signal 

transduction pathways by TGF-β signalling through 

lipoprotein-receptor related protein (LRP-1) 18-21 . Specifically 

the interaction of TGF-β with decorin is of interest 

as decorin is a proteoglycan involved in cell adhesion and 

cell signaling. Decorin belongs to a superfamily of small 

leucine-rich proteoglycans (SLRPs) and it carries a single 

glucosaminoglycan chain attached to its aminoterminus 

and its core protein consists of 12x24-aminoacid leucinerich 

repeats. Furthermore, decorin is expressed in most 

tissues and in the brain its expression is developmentally 

regulated 22,23 . It binds to the insulin-like growth factor-I, 

and interacts with TNF-α 24,25 . Furthermore, by binding to 

the EGF receptor decorin activates the mitogen activated 

protein kinase (MAP kinase) signaling pathways leading 

to p21 induction, and ultimately to cell cycle arrest 26 . 

Previous studies have decorin implicated in suppression 

of tumor cell-mediated angiogenesis 27 , attributed to it a 

functional role in adult brain injury and repair 28 and demonstrated 

that it promotes axonal growth across rat spinal 

cord injuries 7 . 

In this study we monitored the expression of TGF-β 

protein and decorin mRNA in the lumbar region of the 

spinal cord of seven day old rats after unilateral injury of 

the sciatic nerve over a period up to one month. 

Methods 

Nerve crush 

Wistar rats were obtained from the Laboratory of 

Physiology (Medical School, Aristotle University of 

Thessaloniki, Greece). We complied with the guidelines 

for animal use established by the American Physiological 

Society approved by the local ethical committee 

in accordance with EEC Council Directive 86/609. 

The day of birth was counted as P0 (zero). Sciatic nerve 

crush was performed on the left side at the 7 th postnatal 

day (P7) and successful axonotomy was certified postoperatively 

by clinical tests with the right side serving 

as control as described previously 29,30 . Only animals 

in which successful axonotomy was verified were included 

in our study. For each time point we divided the 

animals into two groups, control and nerve crush. Each 

group consisted of at least 7 animals and the TGF-β 

and decorin expression was determined at 12 hours, 24 

hours, 48 hours, 72 hours, 1 week and 1 month after 

axonotomy. 

Cardiac Perfusion 

Control and operated animals, were deeply anaesthetized 

and underwent the procedure of cardiac perfusion 

with a fixative containing paraformaldehyde 4% in phosphate 

buffered saline (PBS). The spinal cord was then 

removed, post-fixed for 4 hours in the same fixative and 

finally stored in 30% sucrose at -40˚ C. 

KRITIS A 

Immunochemistry 

The L4-L5 region of the rat spinal cord was identified 

with the aid of a stereoscope. For identification, the 

control dorsal horn (right side) was marked with a fine 

micropin. Serial frozen sections of 4μm were cut with a 

HM 505 E Microm cryostat, collected on superfrost plus 

glass slides (Fisher Scientific, Pittsburgh, PA, USA) and 

stored at -70˚ C. 

For immuno-staining, the sections were microwave 

fixed with 2% paraformaldehyde 31 incubated for 10 minutes 

in dual endogenous enzyme block solution, for 3 

hours with the primary antibody (diluted to 1:400) according 

to the vendors protocol. The antibody was a 

monoclonal anti-TGF-β1 antibody with possible actions 

for the other isoforms of TGF-β (NCL-TGFB, Novocastra 

Laboratories Ltd Newcastle upon Tyne NE12 8EW, 

U.K.). The sections were then processed using a horseradish 

peroxidase (HRP) conjugated secondary antibody 

for 30 min at room temperature and developed using diamino 

benzidine (DAB) as a substrate. 

mRNA extraction and RT-PCR analysis 

Twelve, 24, 48, 72 hours, 1 week and 1 month after 

the nerve injury, the animals were sacrificed, and the 

region of the spinal cord (L4 – L5) was excised. Total 

RNA was extracted with the RNeasy Mini RNA extraction 

kit from Qiagen (Qiagen Greece BioAnalytica S.A. 

Athens). Two μg of total RNA were subjected to reverse 

transcription using 200 units of MMLV-RT (Promega 

Greece SB Biotechnology Suppliers S.A. Athens) in 100 

μl reaction volume, under standard conditions. Five μl of 

the reverse transcription reaction mixture were subjected 

to PCR amplification in 25 μl reaction volume, including 

primers for the amplification of the beta-actin mRNA as 

internal control for gene expression as described by others 

32,33 . Amplification started with an initial step of 5 min 

denaturation at 94°C followed by 30 cycles, each cycle 

consisted of denaturation at 94°C for 30 sec annealing at 

55°C for 1 min and extension at 72°C for 1 min. Finally, 

the PCR products were extended for 10 min at 72°C. Five 

μl of each PCR reaction mixture were analyzed in a 1.7% 

agarose gel. Visualization of DNA bands was achieved 

with UV illumination of ethidium bromide-stained gels. 

The intensity of the DNA bands was measured using the 

software from Kodak Digital Science 1DTM. 

Primers 

Primers were designed to be specific for both rat and 

human mRNA. For this purpose decorin mRNA sequnces 

for R. rattus (Z12298), R.norvegicus (X59859) and 

Homo sapiens (BC005322) were aligned using the Clustal 

W algorithm and the computing facilities of EBI http:// 

www.ebi.ac.uk/. The primers then were designed out of 

regions of complete homology. For beta-actin sence 5΄ 

ACACTGTGCCCATCTACGAGG 3΄ and antisence 5΄ 

AGGGGCCGGACTCGTCATACT 3΄ providing a pcr 

amplification product of 625 bp and for decorin sence 5΄ 

ATGATTGTCATAGAACTGGGC 3΄ and antisence 5΄

ATTGTTGTTATGAAGGTAGAC 3΄ with an amplicon 

of 385 bp. 

Statistical Analysis 

Non parametric data was analyzed using the Kruskal 

Wallis test and ANOVA. When significant, post hoc analysis 

Dunett test was used. The data is presented as mean 

± SE of n ≥ 6 in each group. Results were considered 

significant with a probability z (p)

Figure 2: Expression of Decorin mRNA was monitored 

from 12 hours after the sciatic nerve crush and over a period 

of one month. (A) The relative mRNA signal intensity 

at each time point is compared with that of the control. Bars 

represent means ± SE. (*) Significant difference compared 

with the control, (p < 0.01) (B). Agerose gel electrophoresis 

of RT-PCR products for decorin and beta-avtin mRNA from 

injured animals at different time points after sciatic nerve 

crush. 

fold compared to those of the control animals (p < 0.01). 

At later time points decorin mRNA expression returned 

to normal levels with small variations of no statistical significance. 

However one month after the nerve crush, the 

levels of decorin mRNA expression were again significantly 

elevated, (p < 0.01), about 2.5–fold compared to 

those of the control animals (Figure 2). 

Discussion 

Our data reveal a biphasic modulation of TGF-β protein 

and decorin mRNA expression at lumbar segment of 

the spinal cord of animals having suffered unilateral sciatic 

nerve crush. This modulation of expression occurs at two 

stages, an early one after 12 hours and a late one, 1 month 

after the axonotomy. Bearing in mind that these molecules 

are functionally related and both alone and together activate 

different signaling pathways we conclude that their 

concerted expression both at an early and a late phase after 

the nerve injury is of importance and can be part of a repair 

or neuroprotective mechanism not clarified yet. 

It is well established that injury to the peripheral nerve 

triggers a complex, developmental stage specific, gene 

expression response, which regulates interplay of motor 

neuron death or survival. It has been reported that in spinal 

cord injuries inflammation is a key feature of this interplay, 

causing substantial secondary damage and thus undermin- 

KRITIS A 

ing the processes of neuroregeneration 34,35 . In addition it 

has been reported that IL-10, a powerful anti-inflammatory 

cytokine, administered at the site of sciatic nerve crush reduced 

scar formation and permitted better regeneration of 

the damaged axons 36 . In this inflammatory response TGFβ 

is an important factor and it has been shown that inhibition 

of its expression by neutralizing antibodies at the site 

of sciatic nerve repair reduced scar formation but did not 

enhance nerve regeneration 37 . In contrast TGF-β inhibition 

by decorin over-expression in the rat brain induced severe 

inflammation and acute neuronal death 37 . Others reported 

that TGF-β is not a neurotrophic factor by itself rather it 

potentiated the action of neurotrophins either though interaction 

with other growth/differentiation factors 38 or by 

activating other signaling pathways such as the MAP Kinases 

pathway (MAPK/ERK/p38) that also has been reported 

to be activated in peripheral nerve injury 39,40 . 

On the other hand decorin has been shown to help 

reduce scar formation by inhibiting the expression of other 

chondroitin sulfate proteoglycans and promote axon 

growth by direct interaction with myelin in adult spinal 

cord injuries 7,41 . Our data is consistent with these reports 

and it would account for the late expression of decorin 

being involved in processes employed in remyelination. 

Additional implication of decorin in nerve repair comes 

from reports stating that the MAPK ERK pathway is activated 

in peripheral nerve after injury 39,40 . 

Our findings are in agreement with the above reports 

and clearly demonstrat that TGF-β and decorin expression 

is modulated as part of the response to sciatic nerve 

injury. This modulation of expression is biphasic and 

includes an early and a late stage consistent with the 

inflammatory process during which both cellular and 

exudative components are mobilized. It is of interest that 

these molecules are expressed in a concerted manner after 

the sciatic nerve crush. Both of these molecules activate 

different branches of the same pathway (MAPK) 

making it an important target for further investigation. 

The fact that TGF-β and decorin are functionally related 

both in a negative and a positive way and are expressed 

simultaneously implies that their function depends on the 

microenvironment created at the site of the injury or that 

it is exerted through other unidentified mechanisms as 

yet. Recent reports revealed that TGF-β required decorin 

for signaling through the large endocytotic lipoprotein 

related receptor-1 18 . It is of interest to elucidate the contribution 

of this pathway to nerve injury and repair and 

whether it is indeed activated upon of sciatic nerve injury. 

This would help identify the events following the injury 

and assign to both TGF-β and decorin specific places in 

the nerve repair processes. 

Conflict of interest: none. 

Acknowledgements 

The authors would like to thank I. Klagas for expert 

technical assistance and Dr. Ch. Pourzitaki for providing 

the statistical analysis of the data.

References 

1. Lawson SJ, Lowrie MB. The role of apoptosis and excitotoxicity 

in the death of spinal motoneurons and interneurons after neonatal 

nerve injury. Neuroscience. 1998; 87: 337-348. 

2. Lowrie MB, Vrbova G. Dependence of postnatal motoneurones 

on their targets: review and hypothesis. Trends Neurosci. 1992; 

15: 80-84. 

3. Navarro X, Vivo M, Valero-Cabre A. Neural plasticity after peripheral 

nerve injury and regeneration. Prog Neurobiol. 2007; 

82: 163-201. 

4. Snider WD, Zhou FQ, Zhong J, et al. Signaling the pathway to 

regeneration. Neuron. 2002; 35: 13-16. 

5. Szpara ML, Vranizan K, Tai YC, et al. Analysis of gene expression 

during neurite outgrowth and regeneration. BMC Neurosci. 

2007; 8: 100. 

6. Hossain-Ibrahim MK, Rezajooi K, Stallcup WB, et al. Analysis 

of axonal regeneration in the central and peripheral nervous 

systems of the NG2-deficient mouse. BMC Neurosci. 2007; 8: 

80. 

7. Davies JE, Tang X, Denning JW, et al. Decorin suppresses neurocan, 

brevican, phosphacan and NG2 expression and promotes 

axon growth across adult rat spinal cord injuries. Eur J Neurosci. 

2004; 19: 1226-1242. 

8. Makwana M, Raivich G. Molecular mechanisms in successful 

peripheral regeneration. FEBS J. 2005; 272: 2628-2638. 

9. Okuyama N, Kiryu-Seo S, Kiyama H. Altered expression of 

Smad family members in injured motor neurons of rat. Brain 

Res. 2007; 1132: 36-41. 

10. Jiang Y, McLennan IS, Koishi K, et al. Transforming growth 

factor-beta 2 is anterogradely and retrogradely transported in 

motoneurons and up-regulated after nerve injury. Neuroscience. 

2000; 97: 735-742. 

11. D’Antonio M, Droggiti A, Feltri ML, et al. TGFbeta type II receptor 

signaling controls Schwann cell death and proliferation in 

developing nerves. J Neurosci. 2006; 26: 8417-8427. 

12. Buss A, Pech K, Kakulas BA, et al. TGF-beta1 and TGF-beta2 

expression after traumatic human spinal cord injury. Spinal 

Cord. 2008; 46: 364-371. 

13. Clark DA, Coker R. Transforming growth factor-beta (TGFbeta). 

Int J Biochem Cell Biol. 1998; 30: 293-298. 

14. Brand T, Schneider MD. Transforming growth factor-beta signal 

transduction. Circ Res. 1996; 78: 173-179. 

15. Massague J, Wotton D. Transcriptional control by the TGF-beta/ 

Smad signaling system. EMBO J. 2000; 19: 1745-1754. 

16. Miyazawa K, Shinozaki M, Hara T, et al. Two major Smad pathways 

in TGF-beta superfamily signalling. Genes Cells. 2002; 7: 

1191-1204. 

17. Wrana JL, Attisano L, Wieser R, et al. Mechanism of activation 

of the TGF-beta receptor. Nature. 1994; 370: 341-347. 

18. Cabello-Verrugio C, Brandan E. A novel modulatory mechanism 

of transforming growth factor-beta signaling through decorin 

and LRP-1. J Biol Chem. 2007; 282: 18842-18850. 

19. Takeuchi Y, Kodama Y, Matsumoto T. Bone matrix decorin 

binds transforming growth factor-beta and enhances its bioactivity. 

J Biol Chem. 1994; 269: 32634-32638. 

20. Yamaguchi Y, Mann DM, Ruoslahti E. Negative regulation of 

transforming growth factor-beta by the proteoglycan decorin. 

Nature. 1990; 346: 281-284. 

21. Droguett R, Cabello-Verrugio C, Riquelme C, et al. Extracellular 

proteoglycans modify TGF-beta bio-availability attenuating 

its signaling during skeletal muscle differentiation. Matrix Biol. 

2006; 25: 332-341. 

22. Iozzo RV. Matrix proteoglycans: from molecular design to cel- 


lular function. Annu Rev Biochem. 1998; 67: 609-652. 

23. Kappler J, Stichel CC, Gleichmann M, et al. Developmental regulation 

of decorin expression in postnatal rat brain. Brain Res. 

1998; 793: 328-332. 

24. Schonherr E, Sunderkotter C, Iozzo RV, et al. Decorin, a novel 

player in the insulin-like growth factor system. J Biol Chem. 

2005; 280: 15767-15772. 

25. Tufvesson E, Westergren-Thorsson G. Tumour necrosis factoralpha 

interacts with biglycan and decorin. FEBS Lett. 2002; 530: 

124-128. 

26. Moscatello DK, Santra M, Mann DM, et al. Decorin suppresses 

tumor cell growth by activating the epidermal growth factor receptor. 

J Clin Invest. 1998; 101: 406-412. 

27. Grant DS, Yenisey C, Rose RW, et al. Decorin suppresses tumor 

cell-mediated angiogenesis. Oncogene. 2002; 21: 4765-4777. 

28. Stichel CC, Kappler J, Junghans U, et al. Differential expression 

of the small chondroitin/dermatan sulfate proteoglycans decorin 

and biglycan after injury of the adult rat brain. Brain Res. 1995; 

704: 263-274. 

29. Gougoulias N, Kouvelas D, Albani M. Protective effect of 

PNQX on motor units and muscle property after sciatic nerve 

crush in neonatal rats. Pharmacol Res. 2007; 55: 370-377. 

30. Gougoulias N, Hatzisotiriou A, Kapoukranidou D, et al. Magnesium 

administration provokes motor unit survival, after sciatic nerve injury 

in neonatal rats. BMC Musculoskelet Disord. 2004; 5: 33. 

31. Barsony J, Pike JW, DeLuca HF, et al. Immunocytology with 

microwave-fixed fibroblasts shows 1 alpha, 25-dihydroxyvitamin 

D3-dependent rapid and estrogen-dependent slow reorganization 

of vitamin D receptors. J Cell Biol. 1990; 111: 2385-2395. 

32. Enomoto T, Fujita M, Cheng C, et al. Loss of expression and loss 

of heterozygosity in the DCC gene in neoplasms of the human 

female reproductive tract. Br J Cancer. 1995; 71: 462-467. 

33. Jonson T, Mahlamaki EH, Karhu R, et al. Characterization of 

genomically amplified segments using PCR: optimizing relative-PCR 

for reliable and simple gene expression and gene copy 

analyses. Genes Chromosomes Cancer. 2000; 29: 192-199. 

34. Fleming JC, Norenberg MD, Ramsay DA, et al. The cellular 

inflammatory response in human spinal cords after injury. Brain. 

2006; 129: 3249-3269. 

35. Yang L, Blumbergs PC, Jones NR, et al. Early expression and 

cellular localization of proinflammatory cytokines interleukin- 

1beta, interleukin-6, and tumor necrosis factor-alpha in human 

traumatic spinal cord injury. Spine. 2004; 29: 966-971. 

36. Atkins S, Loescher AR, Boissonade FM, et al. Interleukin-10 

reduces scarring and enhances regeneration at a site of sciatic 

nerve repair. J Peripher Nerv Syst. 2007; 12: 269-276. 

37. Boche D, Cunningham C, Docagne F, et al. TGFbeta1 regulates 

the inflammatory response during chronic neurodegeneration. 

Neurobiol Dis. 2006; 22: 638-650. 

38. Krieglstein K, Strelau J, Schober A, et al. TGF-beta and the 

regulation of neuron survival and death. J Physiol Paris. 2002; 

96: 25-30. 

39. Yongchaitrakul T, Pavasant P. Transforming growth factor-beta1 

up-regulates the expression of nerve growth factor through mitogen-activated 

protein kinase signaling pathways in dental pulp 

cells. Eur J Oral Sci. 2007; 115: 57-63. 

40. Agthong S, Kaewsema A, Tanomsridejchai N, et al. Activation 

of MAPK ERK in peripheral nerve after injury. BMC Neurosci. 

2006; 7: 45. 

41. Minor K, Tang X, Kahrilas G, et al. Decorin promotes robust 

axon growth on inhibitory CSPGs and myelin via a direct effect 

on neurons. Neurobiol Dis. 2008; 32: 88-95.


PASCHOS KA 

CASE REPORT 

Gitelman syndrome: First report of genetically established diagnosis in Greece 

Galli-Tsinopoulou A 1 , Patseadou M 1 , Hatzidimitriou A 1 , Kokka P 1 , Emmanouilidou E 1 , Lin SH 2 , 

Tramma D 1 

1 4 th Department of Paediatrics, Medical School, Aristotle University of Thessaloniki, Greece 

2 Division of Nephrology, Department of Medicine, Tri-Service General Hospital, Neihu 114, Taipei, Taiwan 

Abstract 

Gitelman syndrome is an inherited renal tubular disorder characterized by hypokalemic metabolic alkalosis. It is 

distinguished from other hypokalemic tubulopathies, such as Bartter syndrome, by the presence of both hypomagnesemia 

and hypocalciuria. We report a case of Gitelman syndrome in a 10-year-old girl who presented for examination 

of persistent unexplained hypokalemia. She had no severe clinical symptoms but she had typical laboratory findings 

including hypokalemia, hypomagnesemia and normocalcemic hypocalciuria. Molecular analysis revealed a mutation in 

the exon 21 of the SLC12A3 gene which encodes the thiazide-sensitive sodium-chloride co-transporter expressed in the 

distal convoluted tubule (a guanine to adenosine substitution at nucleotide 2538). She was treated with oral potassium 

and magnesium supplements. This is the first report of genetically established diagnosis in Greece. Gitelman syndrome 

should be considered as a cause of persistent hypokalemia and genetic analysis might be a useful tool to confirm the 

diagnosis. Hippokratia 2010; 14 (1): 42-44 

Key words: Gitelman syndrome, hypokalemia, hypocalciuria, hypomagnesemia 

Corresponding author: Galli-Tsinopoulou Assimina, 4th Department of Paediatrics, Medical School, Aristotle University of Thessaloniki, 

General Hospital Papageorgiou, Ring Road, Nea Efkarpia, 56403 Thessaloniki, Greece, Tel./Fax +302310 991537, email: galtsin@otenet.gr, 

or assimina@med.auth.gr 

Gitelman syndrome (GS, OMIM: 263800) is a rare 

autosomal recessive inherited renal tubular disorder. It is 

caused by inactivating mutations in the SLC12A3 gene 

that encodes the thiazide-sensitive sodium-chloride cotransporter 

(NCCT or TSC) expressed in the distal convoluted 

tubule of the kidney 1 . It is characterized by hypokalemic 

alkalosis, also found in Bartter syndrome (BS), 

but the hypomagnesemia and normocalcemic hypocalciuria 

are the typical biochemical findings that distinguish 

it from the “classical” BS 1,2 . Main symptoms include mild 

muscular weakness and cramps, occasional episodes of 

tetany, constipation, abdominal pain and vomiting 3,4 . Patients 

are often diagnosed in adulthood during routine 

laboratory investigation due to lack of severe clinical 

features. We report the first genetically confirmed case 

of GS in Greece. 

Case report 

A 10-year-old Greek girl was referred to our department 

in April, 2005 due to persistent hypokalemia of unknown 

origin. Her hypokalemia had first been incidentally 

detected one year ago when she was admitted to a 

primary care health unit for evaluation of severe constipation. 

Until then, she had been free from symptoms. She 

was readmitted to the same hospital 2 weeks ago because 

she started complaining of diarrheas, abdominal pain and 

high temperature. A febrile gastroenteritis accompanied 

with persistent hypokalemia was diagnosed at that time. 

There was nothing remarkable recorded neither from 

the patient’s medical history nor from her family history. 

She denied any medication usage including laxatives or 

diuretics. She was delivered uneventfully at term, with 

normal prenatal history. Her birth weight as well as birth 

length were within normal percentiles. The marriage of 

her parents was not consanguineous. 

At the time of admission in our tertiary department, 

physical examination revealed a well-developed female 

with no signs of dehydration or skin hyperpigmentation. 

Her height was 137 cm (25 th to 50 th percentile) and weight 

34 kg (50 th percentile). Her blood pressure was 100/70 

mmHg and pulse rate 90 beats/min. Cardiovascular examination 

showed a regular rate and rhythm without 

murmurs or gallops. She had neither hepatosplenomegaly 

nor peripheral edema. Neurologic examination showed 

no sensory or motor disorder. 

Laboratory tests revealed normal leukocyte, erythrocyte 

and platelet count. Blood urea nitrogen (BUN) 

was 38 mg/dl, creatinine (Cr) 0.53 mg/dl and glucose 

85mg/dl. Serum electrolyte concentrations were as 

follows: sodium (Na + ) 139 mEq/L, potassium (K +) 2.7 

mEq/L, chloride (Cl - ) 92 mEq/L, calcium (Ca +2 ) 9.86 

mg/dl, phosphorus (P) 3.6 mg/dl, magnesium (Mg +2 ) 

1.2 mg/dl. Analysis of 24 h urine collection revealed: 

extremely decreased calcium excretion (6 mg/d or 0.17 

mg/kg/d), increased potassium excretion (310 mEq/d) 

and normal sodium, chloride, and phosphorus values.

The calculated urine calcium/creatinine ratio was lower 

than 0.1. Analysis of the arterial blood gasses showed 

metabolic alkalosis (PH: 7.49, bicarbonate: HCO3 - 29.4 

mEq/L). The aldosterone serum level was high (100 ng/ 

dl, normal range for age: 4-44 ng/dl) as well as the plasma 

renin activity (10.1ng/ml/h, normal range for age: 

0.5-5.9 ng/ml/h). Serum parathyroid hormone level was 

within normal range (20 ng/dl). No pathological signs 

were found in the electrocardiogram, chest X-ray and 

renal ultrasound. 

Using the diagnostic criteria of Bettinelli et al (urinary 

calcium to creatinine ratio < 0.1 and plasma magnesium 

< 0.65 mmol/L) 5 a clinical diagnosis of GS was 

suspected. Therefore, DNA analysis for detection of 

NCCT gene mutations was performed sending the patient’s 

blood sample in the laboratory of the Nephrology 

Department of the Tri-Service Hospital of Taipei, Taiwan. 

Using genomic DNA from peripheral blood cells, 

the 26 exons of the gene were amplified by the polymerase 

chain reaction and the products were completely 

sequenced by direct sequencing. A mutation was detected 

in the exon 21 of NCCT gene. A guanine to adenosine 

substitution was identified at nucleotide 2538 (G2538A, 

TGG to TGA). This mutation results in a premature stop 

codon from tryptophan at codon 844 (W844stop) in the 

intracellular carboxyl terminus of the gene product. Accordingly, 

the diagnosis of Gitelman syndrome was confirmed. 

Treatment with oral supplementation of potassium 

and magnesium was initiated during hospitalisation of 

the patient. The plasma potassium and magnesium levels 

were improved gradually and finally normalized. At 

present, the patient is maintained on oral magnesium and 

potassium preparations but both serum electrolytes levels 

remain borderline low. 

Discussion 

In 1962 Bartter et al 6 described a syndrome characterized 

by hypertrophy and hyperplasia of the juxtaglomerular 

apparatus of the kidneys and overproduction of 

renin, angiotensin and aldosterone. The two male patients 

(5 and 25 years old respectively) reported then had 

a history of slow growth, polydipsia, polyuria, enuresis 

and weakness. Both of them had normal blood pressure. 

The syndrome was associated with hypokalemic alkalosis. 

In 1966 Gitelman et al 7 described three adult female 

patients with occasional episodes of muscle weakness 

and tetany. Neither growth retardation nor polyuria were 

detected. Hypokalemia, hypomagnesemia and hypocalciuria 

were present. 

We now know that BS defined genetically by an autosomal 

recessive transmission characterized by hypokalemic 

alkalosis with salt wasting, is a heterogenous group 

of disorders with at least two subsets, ‘true’ BS or ‘classical’ 

BS and GS. Each syndrome represents a distinct 

clinical, biochemical and molecular entity. 

BS is caused by defects in the ion transportation 


system in the thick ascending limb of Henle’s loop. 

Mutations of both genes which encode the renal chloride 

channel (C1C-Kb) 8 and the bumetadine-sensitive 

Na-K-2Cl co-transporter (NKCC2) have been identified 

9 . In BS urinary calcium excretion is normal or 

high and serum magnesium levels are also normal. The 

syndrome is usually diagnosed in infancy or childhood, 

usually under the age of five. It is characterized by dehydration, 

polyuria, growth retardation and nephrocalcinosis. 

GS is thought to be more common than BS. In 1996 

Simon et al 1 first demonstrated complete linkage of GS 

with the SLC12A3 gene located on chromosome 16 

(16q13) and consisted of 26 exons. This association has 

also been confirmed by other investigators 10 . Most of 

the genetic abnormalities identified in GS are missense 

mutations localised within the intracellular domains of 

the molecule protein which cause loss of activity of the 

sodium-chloride co-transporter (NCCT). As a result, increased 

sodium and chloride wasting in the distal convoluted 

tubule causes volume contraction. The hypovolemia 

activates the renin–angiotensin–aldosterone system 

and increases the secretion of potassium and hydrogen 

ions in the collecting duct. 

The typical laboratory findings, apart from hypokalemic 

alkalosis, are hypomagnesemia and normocalcemic 

hypocalciuria 1,4 . The presence of these biochemical results 

distinguishes GS from BS. The electrolyte disturbances 

resemble the effects of chronic thiazide administration. 

Patients with GS are usually diagnosed in older 

age (adolescence or adulthood) during routine investigation. 

They are often asymptomatic or have intermittent 

mild symptoms that include muscular weakness, fatigue, 

cramps, occasional episodes of tetany, constipation, abdominal 

pain and vomiting 3,4 . The prognosis is usually 

benign and life expectancy is really high. 

Treatment of GS consists of oral supplementation of 

magnesium and potassium. Magnesium therapy not only 

corrects the hypomagnesemia but also improves the hypokalemia. 

A potassium-sparing diuretic or a combination 

with anti-aldosterone medication and prostaglandin 

inhibitors may also be used. 

Our patient presented with no severe symptoms. She 

was incidentally found to have hypokalemia. Laboratory 

data showed hypomagnesemia and hypocalciuria as well. 

Our suspicion of GS was confirmed after molecular analysis 

was done, which in our knowledge is the first case 

genetically identified in Greek population. 

Table 1 shows the compared features between BS and 

GS and the specific findings identified in our patient. 

We conclude that GS is a disorder with a variable 

symptom profile, but can be suspected on clinical and 

biochemical signs already in childhood. Unexplained hypokalemia 

may be caused by renal tubular disorders, such 

as GS. Electrolyte analysis and hormone evaluations are 

mandatory for differential diagnosis. Genetic analysis 

will further confirm the diagnosis.

Table 1: Features of Bartter and Gitelman syndrome. 

Bartter Gitelman our patient 

Clinical findings 

Dehydration + – – 

Growth retardation + – – 

Polyuria + – – 

Weakness, cramps – + – 

Constipation – + – 

Abdominal pain 

Biochemical findings 

– + – 

Metabolic alkalosis + + + 

Hypokalemia + + + 

Hypomagnesemia – + + 

Hypocalciuria 

Genetic analysis 

– + + 

Renal defect thick ascending distal convoluted distal convoluted 

Henle’s loop tubule tubule 

Mutation C1C-Kb, NKCC2 NCCT NCCT 

References 

1. Simon DB, Nelson-Williams C, Bia MJ. Gitelman variant of 

Bartter syndrome, inherited hypokalemic alkalosis, is caused by 

mutations in the thiazide-sensitive Na-Cl co-transporter. Nature 

Genet. 1996; 12: 24-30. 

2. Barakat AJ, Rennert OM. Gitelman syndrome (familial hypokalemia-hypomagnesemia). 

J Nephrol. 2001; 14: 43-47. 

3. Schmidt H, Kabesch M, Schwarz HP, Kiess W. Clinical, biochemical 

and molecular genetic data in five children with Gitelman 

syndrome. Horm Metab Res. 2001; 33: 354-357. 

4. Lee YT, Wang IF, Lin TH, Huang CT. Gitelman syndrome: report 

of three cases and literature review. Kaohsiung. J Med Sci. 

2006; 22: 357-362. 

5. Bettinelli A, Bianchetti MG, Girardin E, Caringella A, Cecconi 

M, Appiani AC. Use of calcium excretion values to distinguish 

two forms of primary renal tubular hypokalemic alkalosis: Bartter 

and Gitelman syndromes. J Pediatr. 1992; 120: 38-43. 

6. Bartter FC, Pronove P, Gill JR Jr, Maccardle RC. Hyperplasia 

GALLI-TSINOPOULOU A 

of the juxtaglomerular complex with hyperaldosteronism and 

hypokalemic alkalosis. A new syndrome. Am J Med. 1962; 33: 

811-828. 

7. Gitelman HJ, Graham JB, Welt LG. A new familial disorder 

characterized by hypokalemia and hypomagnesemia. Trans Assoc 

Am Physicians. 1966; 79: 221-235. 

8. Simon DB, Bindra RS, Mansfield TA, Nelson-Williams C, Mendonca 

E, Stone R, et al. Mutations in the chloride channel gene, 

CLCNKB, cause Bartter syndrome type III. Nat Genet. 1997; 

17: 171-178. 

9. Simon DB, Karet FE, Hamdan JM, DiPietro A, Sanjad SA, Lifton 

RP. Bartter syndrome, hypokalaemic alkalosis with hypercalciuria, 

is caused by mutations in the Na-K-2Cl co-transporter 

NKCC2. Nat Genet. 1996; 13: 183-188. 

10. Lin SH, Shiang JC, Huang CC, Yang SS, Hsu YJ, Cheng CJ. 

Phenotype and genotype analysis in Chinese patients with 

Gitelman syndrome. J Clin Endocrinol Metab. 2005; 90: 

2500-2507.


HIPPOKRATIA GALLI-TSINOPOULOU PASCHOS 2010, KA 14, A1 

45 

Ocular complications of marfan syndrome. Report of two cases 

Mema V, Qafa N 

University Hospital Centre “Mother Theresa”, Ophthalmologic Service, Tirana, Albania 

CASE REPORT 

Abstract 

Background: Marfan Syndrome occurs in 8 to 10 per 100.000 of population / year 1 . Ocular features of this syn drome 

have been extensively reported. We report two patients in the same family with miscellaneous complications of this 

syndrome. 

Case report: Two sisters with Marfan Syndrome were examined in our clinic. They revealed severe ocular complications 

as bilateral spontaneous complete posterior lens dislocation, total rhegmatogenous retinal detachment, and secondary 

glaucoma. Combined surgical and conservative treatment was applied to both cases with relative successful results. 

They were also referred to cardiologist for further evaluation and management. 

Conclusions: Ocular complications commonly occur in Marfan’s Syndrome. Total rhegmatogenous retinal detachment, 

secondary glaucoma, etc. These findings require prompt and aggressive treatment to minimize visual loss in these patients. 

Hippokratia 2010; 14 (1): 45-47 

Keywords: Marfan Syndrome, Rhegmatogenous retinal detachment, secondary glaucoma, posterior crystalline lens 

dislocation 

Corresponding author: Vilma Mema, University Hospital Centre “Mother Theresa”, Ophthalmologic Service, P.C. 1012, Tirana, Albania, Tel. 

+355 67 20 29 613, e-mail: vilmaoculus@yahoo.com 

Marfan’s Syndrome has been reported to occur in 8 to 

10 per 100.000 of population / year 1 . Ocular features of this 

syn drome have been repeatedly reported 2 . Ectopia lentis, 

the most common ocular feature, occurs in 70 to 80 % of 

cases 3-6 . Isolated reports of spontaneous complete posterior 

crystalline lens luxation, or developing secondary 

complications like glaucoma or uveitis have also been 

described 7 . However, bilateral posterior dislocation is a 

rare feature 5 . 

Two cases-sisters of established Marfan’s Syndrome 

with bilateral spontaneous posterior lens dislocation, total 

rhegmatogenous retinal detachment, secondary glaucoma 

are reported. 

Case 1 

A 32-year-old female presented in our clinic with 

acute painless visual loss in the right eye of two days 

duration and chronic pain in the left eye. Clinical examination 

revealed skeletal abnormalities (long, thin extremities), 

arachnodactyly and high-arched palate;. These 

findings were consistent with Marfan Syndrome (Figure 

1 a-b). Ocular examination demonstrated in the right eye 

a visual acuity of hand movement (no correction) and significant 

decrease (3/20) (sph.+4.5 D; cyl.+1.75 X 170°) 

in the left eye. Intraocular pressure was in the right eye 

13 mm Hg and in the left eye 36 mm Hg. She underwent 

surgery for glaucoma (Trabeculectomy and basal 

iridectomy) in the left eye when she was 18 years old. 

Moreover she referred that her little sister had visual disturbances 

as well. 

Dilated fundus examin ation showed bilateral spon- 

taneous posterior lens dislocation associated with total 

rhegmatogenous retinal detachment in the right eye (Figure 

2 a,b). 

Ultrasonography of the right eye revealed spikes 

consis tent with a total rhegmatogenous retinal detachment 

and a posterior dislocated lens (Figure 2). 

The patient underwent successful retinal detachment 

surgery (Pars Plana Vitrectomy + Silicone Oil Injection) 

in the right eye. The visual acuity at 6 months was 4/20, 

(+6.5 D/+1.00X10°) (Figure 3 a,b). She also received 

antiglaucomatous therapy for the left eye, but with poor 

results (presence of vitreous in the anterior chamber). A 

surgical intervention was also planned in the left eye, but 

till now we got no patient consent to do that. 

She was then referred to a cardiologist were she underwent 

a complete investigation. 

Figure 1. 

Skeletal abnormalities (long, thin extremities) 

(A). 

Arachnodactyly in the same patient (B).

Figure 2: The lack of the lens (left). Fundoscopic view of total rhegmatogenous retinal detachment (center). Ultrasound examination 

of the right eye – Retinal detachment and presumed lens material in the vitreous cavity (right). 

Case 2 

Her little sister (24 years old) presented to the department 

of Ophthalmology after contacting her. The patient 

never been examined by an ophthalmologist in the past. 

She complained for blurred vision in both eyes. Physical 

examination revealed again skeletal abnormalities (long, 

thin extremities), arachnodactyly and high-arched palate. 

These findings were once again compatible with the diagnosis 

of Marfan Syndrome. 

Figure 3: Right eye fundoscopic view 6 months after surgery 

(A). Ultrasound examination of the same eye (B) 

Ocular examination showed diminished visual acuity 

in both eyes (right eye: 6/20,sph.+6.5; left eye: 

6/20,sph.+8.5 D). Intraocular pressure was 17.3 mm Hg 

both eyes. 

Fundus evalu ation showed bilateral spontaneous 

posterior lens dislocation associated with retinal thinning 

and degeneration. Interestingly no tears were noted (Figures 

4,5). 

Figure 4: Right eye. the lack of the lens (left). Fundoscopic 

view of the same eye (right). 

MEMA V 

The patient was treated with spectacles in both eyes. 

She was advised to maintain a close follow-up due to the 

potential of the development of future ocular complications 

(glaucoma, retinal detachment, etc). She was also 

referred to a cardiologist for further evaluation. 

Discussion 

Ocular complications are commonly found in Marfan 

Syndrome. Of them, complete bilateral spontaneous 

posterior lens dislocation is a rare manifestation 5 . Posterior 

dislocation may be silent and rarely causes glaucoma 

or uveitis 7 . 

Vitreous changes are well described in Marfan’s 

Syn drome. Commonly observed changes include liquefaction 

of the gel and posterior vitreous detachment 

(PVD). Presence of fluid vitreous in the anterior chamber 

and PVD in our cases are in agreement with this description. 

Posterior dislocation of lens could have been 

augmented by the disruption of anterior hyaloids face resulting 

in loss of support. Usually these cases are prone 

to have more severe vitreous and retinal pathologies. 

Such complications as total rhegmatogenous retinal 

detachment, secondary glaucoma, need prompt and 

aggressive treatment to minimize the degree of visual 

loss. 

To finalize the need (and duty) to refer the patients 

with Marfan Syndrome to cardiologic evaluation should 

be emphasize in order to decrease morbidity and mortality 

related to cardiovascular complications (aorta aneurysm, 

mitral insufficiency, etc.). 

Figure 5: Left eye.The lack of the lens (left). Fundoscopic 

view of the same eye (right).

References 

1. Harrison’s Principles of Internal Medicine. 15th Edition. The Mc- 

Graw-Hill Companies, Inc. New York 2001. p. 351-355. 

2. Nelson LB, Maumence IH. Ectopia Lentis. Surv Ophthalmol. 

1982; 27: 143-160. 

3. Wybar K, Taylor D (eds). Paediatric Ophthalmolgy, Current aspects. 

Marcel Dekkel Inc. Publ; 1983;20: p. 169-170. 

4. Dean JCS. Marfan Syndrome: clinical diagnosis and management.Eur 

J Hum Genet. 2007; 15: 724-333. 


5. Maumenee IH. The eye in Marfan Syndrome. Trans Am Ophthalmol 

Soc. 1981; 79: 684-733. 

6. Pyeritz RE, Whittum-Hudson JA. Immunohistochemical localization 

of fibrillin in human ocular tissues. Relevance to the Marfan 

Syndrome. Arch Ophthalmol. 1995; 113: 103-109. 

7. Croxwatto JO, Laobardi, A, Malbream ES. Phacotoxic endopthalmities 

with Posterior dislocation lens in Marfan’s Syndrome. 

Ophthalmologica. 1986; 193: 23-26.


GALLI-TSINOPOULOU PASCHOS KA A 

CASE REPORT 

Traumatic corneal flap displacement five years after Laser in situ keratomileusis 

Grezda A, Mema V, Jaho J, Dai J 

Service of Ophthalmology, University Hospital Centre “Mother Theresa”, Tirana, Albania 

Abstract 

Laser in Situ Keratomileusis (LASIK) is the most common surgical procedure for the correction of refractive deviations 

1 . LASIK has been ongoing lately in our country, exclusively in private settings. This is the reason for which our 

clinic has no experience with LASIK procedure and complications following it. 

We are presenting a case of a 23 year-old female with traumatic flap displacement on the left eye, 5 years after the 

original LASIK operation. She was presented to our clinic on the 6 th posttraumatic day. The patient was immediately 

operated and the flap repositioned. The case we present, is the only one treated to our clinic with such a vision-threatening 

complication of LASIK procedure. Hippokratia 2010; 14 (1): 48-50 

Key words: LASIK, correction of refractive deviations, laser, traumatic corneal flap displacement, trauma 

Corresponding author: Arjeta Grezda, Service of Ophthalmology University Hospital Centre “Mother Theresa” 370, Rruga e Dibres 1001 

Tirana/Albania, e-mail: arjeta_demi@yahoo.com, Mobile: +355 69 20 46 189 

Laser in Situ Keratomileusis (LASIK) is the most 

common surgical procedure for the correction of refractive 

deviations. It may correct hypermetropia of up to 4D, 

astigmatism of up to 5D and myopia of up to 12D depending 

on corneal thickness. A very thin corneal flap is 

created using a keratome, the stromal bed is treated with 

excimer laser and then the corneal flap is repositioned, 

at its original position. Most complications associated 

with this procedure are flap-related. The flap slippage 

and dislocation most commonly occurs in the early postoperative 

period and probably as a result of mechanical 

disruption such as forceful blinking, lid squeezing and 

eye rubbing. Late displacement, although rare, has been 

reported previously in the literature 2 . 

LASIK procedure has been ongoing lately in our 

country, exclusively in private settings. Hippokratia 

2010; 14 (1): 1-4 

Case Report 

A 23 year-old female, presented to our clinic, complaining 

of recent onset reduced visual acuity, pain, lacrimation 

and foreign body sensation. The patient reported 

a recent trauma with a piece of rod, 6 days ago. She had 

been treated with topical tobramycin eyedrops, and VitA, 

for a traumatic Lamellar Corneal Perforation in the traumatized 

left eye, without any apparent subjective improvement. 

Her past ocular history entailed a bilateral simultaneous 

LASIK operation 5 years ago (- 3.0 D/-6.0D 

of previous myopia). 

On presentation, the right eye was normal with 10/10 

visual acuity; left eye has 0.06 visual acuity. Slit lamp 

examination disclosed superior lid edema, conjunctival 

hyperemia, flap displacement and folding near the center 

of the cornea and edema of the stromal bed. 

The patient was immediately operated. We had no 

possibility to make any photo pre- or intraoperatively, so 

Figure 1 represents a schematic demonstration of the displacement 

of the corneal flap at the time when the patient 

came to our clinic. 

Figure 1: Schematic demonstration of the displacement of 

the corneal flap of our patient. The dark straight line represents 

the line of the flap folding. The light-grey marked 

area on the right side represents that part of the corneal flap 

which was doubled up and attached over the well-positioned 

nasal one. 

Operation procedure 

OS: Cleaning and repositioning of the corneal flap, 

compressive patching. 

Topical anesthesia with xylocaine 2%. Deep rinsing 

out of the stromal bed with isotonic solution and cleaning 

of the borders of corneal fold mainly from epithelium. 

Careful detachment of the folded and attached flap

from the epithelium using a hokey and repositioning of it. 

Rinsing out with Cephasoline solution and patching. 

Therapy prescribed: Ciprofloxacin and tobramycin 

eyedrops every two hours. 

The third day postoperatively: 

Hyperemia present, minimal chemosis mainly inferiorly. 

LASIK flap is well positioned. The flap border 

is more elevated temporally and inferiorly (1.00-5.00 

o’clock) and it represents some haziness. The cornea is 

almost clear and fully adherent super-nasally. 

We have photos of both eyes this day (Figure 2 and 

3). 

Figure 2: Right eye photo in the 3 rd day. 

Figure 3: Left eye photo in the 3 rd day. 

The fourth day: 

The eye is quiet. The corneal flap is hazy and edematous 

with temporal and inferior elevated borders. Initial 

neovascular growth at 12 o’clock. Soft contact lens was 

placed. Tobramycin eyedrops was replaced with a tobramycin 

and topical dexamethasone eyedrops. 

The eighth day: 

The eye is quiet. The contact lens is well positioned. 


The corneal flap is almost at the same level with the peripheral 

corneal epithelium. The haziness is much more 

subtle especially in the periphery. The central haziness is 

more apparent. 

Figure 4: Left eye photo in the 8 th day. 

The ninth day: 

The eye is completely quiet, without hyperemia. The 

contact lens is well positioned. Flap haziness is subtle. 

The visual acuity is 3/10 with the soft contact lens of -5.0 

D. The patient will be followed as an outpatient. 

Discussion 

It is thought that adhesion occurs only in the anterioposterior 

plane and probably never happens in the tangential 

plane. Injuries due to shearing mechanisms such 

as a fingernail injury or a contact lens injury can more 

often cause flap displacement than seemingly heavier injury 

in the anterio-posterior direction such as boxing or 

blunt ocular trauma from occupational hazards. Patients 

should be warned for such sequelae. Likewise, foreign 

body removal with a spud or needle on a LASIK flap also 

carries a similar risk, acting like a shearing force. 

The postulated mechanism for an early flap adherence 

includes endothelial pumping, capillarity, fiber interlacing, 

intracorneal suction, intracorneal molecular 

attraction and ionic bonding 3 . Whatever the mechanism, 

the ease at which a flap can be lifted months after surgery 

for retreatment indicates that the flap actually never heals 

completely 4 . The human corneal stroma typically heals 

after LASIK in a limited and incomplete fashion; the center 

and paracentral stromal LASIK wounds have been reported 

to heal by producing a hypocellular primitive stromal 

scar. This is very weak in tensile strength, averaging 

2.4% of normal, displaying no evidence of remodeling 

over time in specimens out to 6.5 years after surgery. In 

contrast, the more superficial flap margin stromal LASIK 

wound, which is adjacent to the surface epithelium was 

found to heal by producing a 10-fold stronger, peripheral 

hypercellular fibrotic stromal scar that reaches maximum 

tensile strength by approximately 3.5 years after surgery, 

averaging 28.1% of normal.

In conclusion, the fragile adherence of the corneal 

flap even years after a LASIK procedure merits a discussion 

between the ophthalmologist and the patient. It 

should be a part of all informed consent procedures during 

LASIK surgery. 

References 

1. Jack J. Kanski. Clinical Ophthalmology A systematic Approach, 

5 th Edition; 2003; p. 152. 

GREZDA A 

2. Srinivasan M, Prasad S, Prajna NV. Late dislocation of LASIK 

flap following fingernail injury. Indian J Ophthalmol. 2004; 52: 

327-328. 

3. Perez EP, Viramontes B, Schor P, Miller D. Factors affecting corneal 

strip stroma to stroma adhesion. J Refract Surg. 1998; 14: 

460-462. 

4. Schmack I, Dawson DG, McCarey BE, Waring GO 3 rd , Grossniklaus 

HE, Edelhauser HF. Cohesive tensile strength of human 

LASIK wounds with histologic, ultrastructural and clinical correlations. 

J Refract Surg. 2005; 21: 433-445.



Erythema nodosum associated with Salmonella enteritidis 

Mantadakis E, Arvanitidou V, Tsalkidis A, Thomaidis S, Chatzimichael A 

Department of Paediatrics, Democritus University of Thrace, Alexantroupolis, Thrace, Greece 

Abstract 

Background: Erythema nodosum (EN) is the most frequent type of panniculitis in childhood. Although frequently 

idiopathic, it may be associated with a wide variety of conditions ranging from infections, to sarcoidosis, to collagen 

vascular diseases to drugs. 

Case report: We present an 8-year-old boy who developed EN during the course of febrile gastroenteritis due to salmonella 

enteritidis. He received intravenous ampicillin 150 mg/kg/day divided in equal doses every six hours for 10 days. 

The skin lesions gradually disappeared, and he recovered fully without sequelae. 

Conclusions: Salmonellosis should be considered in the differential diagnosis of EN in children with gastrointestinal 

symptoms, and stool cultures should be performed when indicated. Hippokratia 2010; 14 (1): 51-53 

Key words: erythema nodosum, children, differential diagnosis, salmonellosis 

Corresponding author: Mantadakis E, Department of Paediatrics, University Hospital of Alexandroupolis, 6th Kilometer Alexandroupolis- 

Makris, P.C: 68 100 Alexandroupolis, Thrace, Greece, tel.: +302551074411, fax:+302551030340, email: emantada@med.duth.gr 

Erythema nodosum (EN) is the most frequent type 

of panniculitis in childhood with a prevalence of 2.4 per 

10,000 population. It occurs more rarely in children than 

in adults 1,2 . EN represents a hypersensitivity reaction 

seated in the subcutaneous fat. It is associated with numerous 

insults. The cutaneous lesions evolve into a spectrum 

of colours resembling bruises. The inflammation is 

focused primarily in the subcutaneous septa with common 

peripheral lobular involvement 3 . Importantly, the lesions 

of EN neither ulcerate nor scar. In children, there is 

no sex predilection, while in adolescence and adults there 

is a clear female predominance 1 . 

A case of EN in a child that occurred during an episode 

of gastroenteritis due to Salmonella enteritidis is 

described. A brief review of the relevant literature is also 

carried out. 

Case presentation 

An 8-year-old boy presented in the emergency room 

with vomiting and abdominal pain during the last two 

days. On admission the child was afebrile, normotensive 

with signs of mild dehydration. Physical examination revealed 

mild abdominal pain on deep palpation, without 

rebound tenderness or hepatosplenomegaly. Moreover, 

he had four well-demarcated, painless, warm, palpable 

erythematous nodules in both shins. He was not receiving 

any medications. His previous medical history and 

the family history were non-contributory. A throat culture 

showed normal oropharyngeal flora, while a complete 

blood count demonstrated leukocytes 11,420/μl 

(77% neutrophils, 15% lymphocytes, 5% monocytes), 

hemoglobin 12.5 g/dl, hematocrit 36.1% and platelets 

406,000/μl. Liver function tests, serum electrolytes cre- 

CASE REPORT 

atinine and urea were normal. Immunological work-up 

showed IgG 1,470 mg/dl, IgA 286 mg/dl, IgM 157 mg/dl, 

IgE 660U/ml, normal C3 and C4, CRP 8.4mg/dl, while 

no antinuclear antibodies were detected. Erythrocyte 

sedimentation rate was 60mm/ hour. Epstein Barr virus 

and Mycoplasma pneumoniae serologies were consistent 

with past infections, while serologies for Chlamydia 

pneumoniae were negative. A chest radiograph showed 

normal findings. A purified protein derivative skin test for 

tuberculosis was negative. Due to high fever up to 39°C 

and persistent diarrhea with 2 to 3 watery bowel movements 

per day, stool cultures were sent and grew Salmonella 

enteritidis. The isolated pathogen was sensitive to 

co-amoxiclav, ampicillin, piperacillin/tazobactam, ticarcillin/clavulanic 

acid, cefotaxime, ceftazidime, imipenem, 

ciprofloxacin, and trimethoprim/sulfamethoxazole. 

The strain was resistant to cephalothin, cefaclor, nalidixic 

acid, netilmicin, tobramycin, amikacin, and nitrofurantoin. 

He received intravenous ampicillin 150 mg/kg/day 

divided in equal doses four times/day for 10 days. Prior to 

ampicillin, a second blood culture was obtained and was 

also sterile. The second day of ampicillin treatment his 

clinical condition improved and he defervesced. The skin 

lesions gradually resolved and completely disappeared 

over the next 10 days. At the same time his stools normalized. 

A repeat stool culture after the end of the 10-day 

ampicillin therapy was negative for S. enteritidis. At the 

3-month follow-up, he remained in excellent health. 

Discussion 

EN is a painful disorder of subcutaneous fat characterized 

by the sudden appearance of symmetrical erythematous, 

warm, tender, and hard nodules, usually located on

the anterior surface of the lower extremities, especially 

the tibias. Less common sites of involvement are the 

trunk, the face, the neck and the arms. EN is uncommon 

in children, especially those under the age of two years. 

Despite that, it remains the most frequent type of panniculitis 

in pediatrics 1 . Most direct and indirect evidence 

support the involvement of a type IV delayed hypersensitivity 

reaction to antigens derived from infections, 

sarcoidosis, collagen vascular diseases or drugs, such as 

penicillin, phenytoin, sulfonamides, other antibiotics, or 

hormonal contraceptives 4 . The most common identifiable 

cause is streptococcal pharyngitis 5 , but it may be also the 

first sign of a systemic disease, such as tuberculosis, sarcoidosis, 

rheumatologic diseases, autoimmune disorders, 

inflammatory bowel diseases and cancer 1 . Rarely, EN has 

been linked to bacterial or deep fungal infections, such 

as cat-scratch disease 6 , leptospirosis 7 , or sporotrichosis 8 

and with viral infections (hepatitis B, C, EBV) and vaccinations 

9-11 . Fever, malaise and arthralgias may develop 

before or during the course of EN. Initially, the nodules 

show a bright red colour. After a few days they become 

purplish, and, finally exhibit a yellow or greenish appearance. 

The lesions exist for a period of 2 to 6 weeks; they 

never ulcerate, and usually resolve without atrophy or 

scarring 4 . The main treatment of EN is that of the underlying 

conditions, if known. Aspirin and other non-steroidal 

anti-inflammatory agents in full doses are frequently 

prescribed and often are adequate treatment, although we 

did not use them in our case 12 . 

In a retrospective study of 45 children, the most frequent 

etiology was tuberculosis (10 patients), followed 

by S. enteritidis (7 patients), group A β-hemolytic Streptococcus 

(3 patients), Salmonella typhimurium, Campylobacter 

jejuni (2 patients each), and Yersinia enterocolitica, 

EBV-related infectious mononucleosis, cat scratch 

disease, BCG vaccination, chronic hepatitis B infection, 

and amoxicillin treatment (1 patient each). 

Etiology remained unknown in 15 cases. Interestingly, 

the last case of EN that was associated with tuberculosis 

in this series dated back to 1991, after which 

the most frequent etiologic factors were gastrointestinal 

pathogens 13 . In another study from Spain, where 22 

children were diagnosed with EN, the etiologic factors 

were determined in 77% of the patients. Tuberculosis 

was the most frequent cause (36%); in 22% of the 

cases, no reason was identified 14 . In a series of 35 children 

with EN from Switzerland dating back to 1977, 

infections other than tuberculosis were implicated in 20 

cases, including 10 streptococcal infections and 3 cases 

of infectious gastroenteritis due to S. enteritidis and Y. 

enterocolitica. Interestingly, non-infectious inflammatory 

diseases, such as ulcerative colitis, Crohn’s disease, 

Behcet’s disease and sarcoidosis were responsible 

for another 8 cases 15 . In a series of 24 children from 

Israel, streptococcal infections were implicated in one 

quarter of the cases, followed by EBV infections and 

inflammatory bowel diseases, while in one-third of the 

cases, no specific cause could be identified 16 . Finally, in 

MANTADAKIS E 

a recent series from Turkey of 10 children with a mean 

age of 8.8 years, the etiology of EN was established in 

5 cases. Three had streptococcal infection, while 2 were 

diagnosed with primary tuberculosis 17 . In a recent adult 

series (mean age: 37 years old) from the same country, 

the leading etiology was also streptococcal infections 

and responsible for 11% of the cases. In that series, 

sore throat, diarrhea, arthritis, and pulmonary pathology 

were predictors of secondary EN 18 . 

Regarding Greece, to the best of our knowledge, there 

is only one relevant publication. Thirty-five children with 

EN (17 boys and 18 girls, with a mean age of 8.8 years) 

were prospectively studied. In 27 of them (77%), the etiology 

of EN was confirmed by laboratory investigations. 

In 25 children the causative factor was infectious, including 

β-hemolytic Streptococcus in 17 cases, and Mycobacterium 

tuberculosis in two, whereas in two patients 

EN was associated with Crohn’s disease and Hodgkin’s 

disease, respectively 19 . In this series, no case of EN was 

linked to gastroenteritis due to Salmonella spp. Apparently, 

the frequency with which Salmonella spp. are linked 

to EN is a matter of both the prevalence of salmonellosis 

and the genetic composition of the population involved. 

Diagnostic evaluation after comprehensive history 

and physical examination should include complete blood 

count with differential; erythrocyte sedimentation rate, 

serum C-reactive protein, or both; and testing for streptococcal 

infection. In atypical or chronic cases, when the 

lesions persist for many weeks or in recurrences, a biopsy 

is also indicated 20 . 

Conclusions 

The list of possible etiologic factors in EN is extensive. 

A symptom and clinical sign-based cost-effective 

diagnostic approach is essential. Salmonellosis should 

be considered in the differential diagnosis of EN in children 

with gastrointestinal symptoms, while stool cultures 

should be performed when indicated. 

References 

1. Ryan TJ. Erythema nodosum. In: Rook A, Wilkinson DS, Ebling 

FJG, Champion RH, Burton JL (eds). Textbook of dermatology. 

5 th edition. Oxford: Blackwell Scientific. 1992; 1931-1938. 

2. Labbe L, Perel Y, Maleville J, Taοeb A. Erythema nodosum in 

children: a study of 27 patients. Pediatr Dermatol. 1996; 13: 

447-450. 

3. White WL, Hitchcock MG. Diagnosis: erythema nodosum or 

not? Semin Cutan Med Surg. 1999; 18: 47-55. 

4. Requena L, Sanchez Yus E. Erythema nodosum. Semin Cutan 

Med Surg. 2007; 26: 114-125. 

5. Tay YK. Erythema nodosum in Singapore. Clin Exp Dermatol. 

2000; 25: 377-380. 

6. Sarret C, Barbier C, Faucher R, Lacombe P, Meyer M, Labbι A 

Erythema nodosum and adenopathy in a 15-year old boy: uncommon 

signs of cat scratch disease. Arch Pediatr. 2005; 12: 

295-297. 

7. Buckler JM. Leptospirosis presenting with erythema nodosum. 

Arch Dis Child. 1977; 52: 418-419. 

8. Gutierrez Galhardo MC, de Oliveira Schubach A et al. Erythema 

nodosum associated with sporotrichosis. Int J Dermatol. 2002; 

41: 114-116.

9. Domingo P, Ris J, Martinez E, Casas F. Erythema nodosum and 

hepatitis C. Lancet. 1990; 336 (8727): 1377. 

10. Maggiore G, Grifeo S, Marzani MD. Erythema nodosum and 

hepatitis B virus (HBV) infection. J Am Acad Dermatol. 1983; 

9: 602-603. 

11. Llorens-Terol J, Martinez-Roig A. Erythema nodosum associated 

with infectious mononucleosis. Helv Paediatr Acta. 1983; 

38: 91-94. 

12. Atzeni F, Carrabba M, Davin JC et al. Skin manifestations in 

vasculitis and erythema nodosum. Clin Exp Rheumatol. 2006; 

24 (1 Suppl 40): S60-66. 

13. Sota Busselo I, Onate Vergara E, Perez-Yarza EG, Lσpez Palma 

F, Ruiz Benito A, Albisu Andrade Y. Erythema nodosum: etiological 

changes in the last two decades. Anales de Pediatria. 

2004; 61: 403-407. 

14. Artola Aizalde E, Gorrotxategui Gorrotxategui P, Lopez Palma 

F et al. Erythema nodosum in pediatric patients. A study of 22 


cases. Anales Espanoles de Pediatria. 1993; 39: 191-193. 

15. Hassink RI, Pasquinelli-Egli CE, Jacomella V, Laux-End R, 

Bianchetti MG. Conditions currently associated with erythema 

nodosum in Swiss children. Eur J Pediatr. 1997; 156: 851-853. 

16. Garty BZ, Poznanski O. Erythema nodosum in Israeli children. 

Isr Med Assoc J. 2000; 2: 145-146. 

17. Cengiz AB, Kara A, Kanra G, Seçmeer G, Ceyhan M. Erythema 

nodosum in childhood: evaluation of ten patients. Turk J Pediatr. 

2006; 48: 38-42. 

18. Mert A, Kumbasar H, Ozaras R et al. Erythema nodosum: an 

evaluation of 100 cases. Clin Exp Rheumatol. 2007; 25: 563- 

570. 

19. Kakourou T, Drosatou P, Psychou F, Aroni K, Nikolaidou P. 

Erythema nodosum in children: a prospective study. J Am Acad 

Dermatol. 2001; 44: 17-21. 

20. Mana J, Marcoval J. Erythema nodosum. Clin Dermatol. 2007; 

25: 288-294.


PASCHOS KA 

Symptomatic splenoma (hamartoma) of the spleen. A case report 

Tsitouridis I 1 , Michaelides M 1 , Tsitouridis K 1 , Davidis I 1 , Efstratiou I 2 

Hamartoma of the spleen (splenoma) is a rare benign 

tumor composed of an aberrant mixture of normal spleen 

tissue 1-3 . Herein, we present a case of a relatively small 

(35 mm at histopathology), non-palpable symptomatic 

splenoma in a 64-year-old female patient presented with 

anemia and thrombocytopenia that resolved completely 

after splenectomy. 

Case report 

A 64-year-old female patient with free past medical 

history was referred to our department for abdominal ultrasound 

(US) during investigation of anemia and throm- 

CASE REPORT 

1 Department of Diagnostic and Interventional Radiology, Papageorgiou General Hospital, Thessaloniki, Greece 

2 Department of Pathology, Papageorgiou General Hospital, Thessaloniki, Greece 

Abstract 

Hamartomas of the spleen (splenomas) are very rare benign tumors composed of an aberrant mixture of normal 

splenic elements. Herein we present a unique case of a symptomatic non-palpable splenoma in a 64-year-old female 

patient presented with anemia and thrombocytopenia and we describe imaging findings in ultrasound, computed tomography 

and magnetic resonance imaging. To our knowledge, this is the first case of a relatively small splenic hamartoma 

(35 mm at histopathology) associated with thrombocytopenia and anemia that resolved completely several months after 

splenectomy. Hippokratia 2010; 14 (1): 54-56 

Key words: spleen, splenoma, hamartoma 

Corresponding Author: Michaelides M, Department of Diagnostic and Interventional Radiology, Papageorgiou General Hospital, Thessaloniki, 

Greece, Thessaloniki Ring Road, Nea Eukarpia, 56403, Tel: 00302310693336, Fax: 00302310693320, e-mail: michaelidesm@ 

yahoo.com 

bocytopenia. US revealed a solid, slightly hyperechoic 

mass in the upper pole of the spleen with a maximal diameter 

of 51 mm, with sharp borders and with internal 

vascularization on Power Doppler (Figure 1). 

Further investigation with triphasic helical computed 

tomography (CT) was performed the same day. During 

arterial phase the lesion demonstrated intense inhomogeneous 

enhancement, similar to splenic parenchyma, with 

a peripheral enhancing rim. In portal phase the lesion was 

more hyperdense than splenic parenchyma, while in the 

delayed phase, the lesion demonstrated delayed ‘wash 

out’ (Figure 2). 

Figure 1: US of the splenic lesion, demonstrating a well defined hyperechoic lesion in the upper pole of the spleen (A) with 

increased internal vascularization in Power Doppler (B).


Figure 2: Triphasic spiral CT demonstrating the lesion with intense, inhomogeneous enhancement during arterial phase (A). 

In portal phase the lesion is hyperdense compared to normal splenic parenchyma (B). Delayed “wash out” is demonstrated in 

the delayed phase (C). 

Magnetic resonance imaging 

(MRI) of the abdomen was performed 

the next day. The lesion 

demonstrated intermediate to high 

signal intensity in T2-Haste images 

comparative to normal spleen 

parenchyma, with homogenous intense 

enhancement after administration 

of gadolinium (Figure 3). 

Splenectomy was finally performed 

a week later because of persistent 

patient’s symptoms. Histopathological 

evaluation confirmed 

the diagnosis of a splenoma with 

Figure 3: MRI of the lesion, with increased signal intensity relatively to the normal 

greatest diameter of 35 mm, with 

splenic parenchyma on axial T2-Haste images (A) and heterogeneous enhancement 

on axial T1-Flash images after intravenous administration of gadolinium (B). 

the tumor consisting exclusively 

from red pulp that was positive in 

CD-31, CD-34 and CD-45 RO immunohistochemical 

strains (Figure 4). The rest of the splenic parenchyma 

was normal. 

Finally, the patient was discharged from the hospital 

on the 12th postoperative day. Blood counts returned to 

normal values 4 months later, and 24 months after, the 

patient is still asymptomatic, in general good condition 

and with normal blood counts. 

Discussion 

Splenoma is a rare benign tumor which consists of 

aberrant splenic tissue 1 . It was first described in 1861 by 

Rokitansky and since then about 140 cases have been reported. 

Its frequency in autopsy series is reported to be 

0,024-0,13% 2 . Splenomas are usually discovered incidentally 

in all ages with supremacy in elderly women. 

Although splenomas are usually asymptomatic, they may 

rarely cause symptoms due to splenomegaly (a feeling 

of weight in the left upper quadrant, splenic rupture) or 

due to hypersplenism (anemia, thrombocytopenia) 3 . They 

may coexist with other hamartomas in other organs, with 

tuberous sclerosis and with Wiskott - Aldrich - like syndrome. 

A relationship with other neoplastic diseases has 

been also reported 4,5 . To our knowledge, this is the first 

described case of a relatively small splenoma (35 mm at 

Figure 4: A. Surgical specimen showing a well circumscribed 

lesion with a maximum diameter of 35mm in the 

spleen. B. Histological section showing the cells of red pulp 

of the lesion (HE X 200). C. Immunohistochemical staining 

showing the cells to react with factor CD-31.

histopathology) in an adult patient causing signs of hypersplenism 

(anemia and thrombocytopenia). In adults, 

reported symptomatic splenomas that manifested with 

signs of hypersplenism (anemia, thrombocytopenia) 

were larger than 9 cm 6,7. In children, solitary splenomas 

causing signs of hypersplenism were larger than 4 cm (4- 

18cm). There are also reported cases of children presented 

with signs of hypersplenism with multiple splenomas, 

ranging from 2-5cm 3,8-11 . 

Splenomas are well circumcised, solid nodular lesions 

that compress the splenic parenchyma without infiltrating 

it. They are usually solitary tumors that rarely contain 

calcifications or grow to huge dimensions. A splenoma 

with a diameter of 19 cm has been reported 12 . Histologically 

3 types of splenoma have been described. Type I 

develops from the white pulp and consists of abnormal 

lymphoid tissue. Type II develops from red pulp and consists 

of abnormal sinuses complex. Type III which is the 

most common type, is a combination of types I and II and 

contains elements of both types 6,13 . 

Imaging findings of splenomas are not specific and 

depend on their type. On US, splenomas are usually 

solid, homogenous lesions with sharp borders. They can 

rarely demonstrate cystic degeneration and calcifications, 

which are due to ischaemia or hemorrhage. They are usually 

hyperechoic related to the normal splenic parenchyma 

with intense vascularization on Color Doppler 14 . Only 

one case of avascular splenoma has been reported, that 

showed large amorphous calcifications 15 . On CT, splenomas 

are usually isodence to normal splenic parenchyma, 

before and after intravenous administration of contrast 

media. Usually, the only finding is an abnormality of the 

splenic contour, with no signs of invasion. An intense 

heterogeneous enhancement in the arterial phase and on 

delayed images like in our case has also been reported 7 . 

On MRI splenomas are isointense to splenic parenchyma 

on T1 weighted images and hyperintense on T2 weighted 

images. After gadolinium administration, they usually 

demonstrate heterogeneous enhancement 16 . 

Radiological differential diagnosis of splenoma 

should include solid mass–forming lesions of the spleen 

such as lymphoma, metastatic lesions, inflammatory myofibroblastic 

tumor, disseminated fungal or mycobacterial 

infections, sarcoidosis and vascular tumors of the spleen, 

including hemangioma, littoral cell angioma, lymphangioma, 

hemangioendothelioma, sclerosing angiomatoid 

nodular transformation of the spleen and angiosarcoma. 

Immunohistochemically the lining cells of the vascular 

channels of the splenoma are positive for endothelial 

markets CD-8, CD-31, factor VIII–related antigen and 

vimentin and negative for endothelial markets CD-21 and 

TSITOURIDIS I 

CD-68, although endothelial market CD-68 is positive in 

scattered stromal macrophages 13 . 

In conclusion, although splenoma is a very rare tumor, 

it must be included in the differential diagnosis of 

splenic lesions. To our knowledge, this is the first case 

of a relatively small splenoma associated with thrombocytopenia 

and anemia that resolved completely a 

few months after splenectomy. Based on patient’s history 

and follow up, we assume that splenoma, although 

small, demonstrated abnormal splenic over-functionality, 

mimicking hypersplenism, since spleen size and histology 

were normal and blood counts returned to normal 

after splenectomy. 

References 

1. Silverman ML, Livolsi VA. Splenic Hamartoma. Am J Clin 

Pathol 1978; 70: 224-229. 

2. Lam KY, Yip KH, Peh WC. Splenic vascular lesions: unusual 

features and review of the literature. Aust N J Surg 1999; 69: 

422-425. 

3. Lozzo RY, Haas JE, Chard RL. Symptomatic splenic hamartoma: 

a report of two cases and review of the literature. Pediatrics 

1980; 66: 261-265. 

4. Darden JW, Teeslink R, Parrish A. Hamartoma of the spleen: 

a manifestation of tuberous sclerosis. Am Surg. 1975; 41: 564- 

566. 

5. Huff DS, Lischner HW, Go HC, DeLeon GA. Unusual tumors in 

two boys with Wiskott-Aldrich-like syndrome. Lab Invest.1979; 

40: 305-306. 

6. Compton CN, McHenry CR, Aijazi M, Chung-Park M. Thrombocytopenia 

caused by splenic hamartoma: resolution after splenectomy. 

South Med 2001; 94: 542-544. 

7. Zissin R, Lishner M, Rathaus V. Case report. Unusual presentation 

of splenic hamartoma; computed tomography and ultrasonographic 

findings. Clin Radiol1992; 45: 410-411. 

8. Abramowsky C, Alvarado C, Wyly JB, Ricketts R. “Hamartoma” 

of the spleen (splenoma) in children. Pediatr Dev Pathol. 

2004; 7: 231-236. 

9. Thompson SE, Walsh EA, Cramer BC, et al. Radiological features 

of a symptomatic splenic hamartoma. Pediatr Radiol 1996; 

26: 657–660. 

10. Hayes TC, Britton HA, Mewborne EB, Troyer DA, Saldivar VA, 

Ratner IA. Symptomatic splenic hamartoma: case report and literature 

review. Pediatrics 1998; 101: E10. 

11. Havlik RJ, Touloukian RJ, Markowitz RI, Buckley P. Partial 

splenectomy for symptomatic splenic hamartoma. J Pediatr Surg 

1990; 25: 1273-1275. 

12. Garvin DF, King FM. Cysts and nonlymphomatous tumors of 

the spleen. Pathol Annu 1981;16: 61-80. 

13. Lee H, Maeda K. Hamartoma of the spleen. Arch Pathol Lab 

Med. 2009; 133: 147-151. 

14. Brinkly AA, Lee JK. Cystic hamartoma of the spleen. CT and 

sonographic findings. J Clin Ultrasound 1981; 9: 136-138. 

15. Komaki S, Gombas OF. Angiographic demonstration of a calcified 

splenic hamartoma. Radiology 1976; 121: 77-78. 

16. Ramani M, Reinhold C, Semelka RC, et al. Splenic hemangiomas 

and hamartomas. MR imaging characteristics of 28 lesions. 

Radiology 1997; 202: 166-172.



GUIDELINES OF HELLENIC SOCIETY 

OF SLEEP DISORDERS (HSSD) 

Guidelines for Diagnosing and Treating Sleep related Breathing Disorders 

in Adults and Children (Part 3: Obstructive Sleep Apnea in Children, 

Diagnosis and Treatment) 

Tsara V, Amfilochiou A, Papagrigorakis JM, Georgopoulos D, Liolios E, Kadiths A, Koudoumnakis E, 

Aulonitou E, Emporiadou M, Tsakanikos M, Chatzis A, Choulakis M, Chrousos G 

Hippokratia 2010; 14 (1): 57-62 

Key words: children sleep disorders, Greek sleep studies guidelines, snoring, obesity adenotonsilectomy, CPAP 

Corresponding author: Tsara Venetia, PO BOX 50609, Postal Code 54013, Thessaloniki Greece, tel 0030 2310276929, fax 0030 2310358470, 

e-mail : bpneumonologiki@yahoo.gr 

Obstructive sleep apnea syndrome (OSAS) in childhood 

is characterized by intermittent partial or complete 

collapse of the upper airway (obstructive hypopnea or 

apnea). Airflow reduction or even cessation may be associated 

with lung hypoventilation and hypoxemia or 

compromise normal sleep architecture. 

Definitions in pediatrics 

The term obstructive sleep related breathing disorders 

includes a variety of pathologic conditions ranging from 

primary snoring and upper airway resistance syndrome to 

obstructive sleep apnea- hypopnea syndrome. 

Apnea: It is defined as absence of oral and nasal airflow 

for at least two respiratory cycles. Central apnea is 

characterized by absence of respiratory effort, whereas 

obstructive apnea is characterized by continuous respiratory 

effort without airflow. Mixed apneas have both 

central and obstructive features without intervention of 

normal respiration. 

Obstructive apnea is considered clinically significant 

regardless of presence of desaturation or arousals. Central 

apnea is clinically significant only if it is followed by 

hemoglobin desaturation by at least 3% or by an arousal. 

It is also evaluated as significant when it lasts more than 

20 seconds, regardless of presence of arousal or desaturation. 

Hypopnea is defined as reduction in airflow waveform 

width by at least 50% compared to width recorded 

at the longest period of normal sleep, for at least two respiratory 

cycles. Clinically significant hypopneas have 

duration greater than two respiratory cycles and are associated 

with hemoglobin desaturation by at least 3% or 

with an arousal. 

Primary snoring describes presence of snoring without 

apnea or hypopnea, hypercapnia, hypoxemia, high 

arousal index, disruption of normal sleep architecture or 

daytime symptoms. 

Epidemiology 

Sleep related breathing disorders are met at all ages 

from infancy to puberty 1 . Prevalence of repeated snoring 

(> 3 nights/week) is estimated at 3.2%-12.1% 2-4 , whereas 

frequency of OSA is 0.7%-2.9%. A study in 3,680 patients 

from Thessalia, Greece, aged 1-18 years old revealed a 

history of repeated snoring in 4.2% and OSAS in 4.3%. 

Clinical presentation 

Snoring is the most common and characteristic symptom 

of OSAS and it is caused by partial pharyngeal occlusion. 

It is produced during inhalation. Its frequency 

may be low, when it is produced by vibrations of uvula, 

soft palate, tongue and other soft tissues of the oropharyngeal 

wall or high, when adenotonsillar hypertrophy is 

obstructing soft palate movements. 

Many children with OSAS experience increased respiratory 

effort during sleep. Signs of laborious respiration 

are intercostal retractions, use of auxilliary respiratory 

muscles and paradox breathing. 

Apneas are usually witnessed by parents as short 

breathing intervals 8-10 . Moreover, OSAS can be associated 

with unrefreshing sleep, arousals, unusual body position, 

increased perspiration and oral breathing 11-13 . Children 

with OSAS usually suffer from daytime sleepiness, 

hyperactivity and behavioral disorders 1,14-16 . 

Pathogenesis of OSAS and adenotonsillar 

hypertrophy 

Obstructive sleep apnea-hypopnea syndrome is a 

combination of anatomic and neuromuscular parameters. 

Contrary to nose, larynx and trachea, the pharyngeal 

airway is not supported by bones or cartilages but 

mostly comprises of soft tissues. During inspiration, 

diaphragmatic contraction produces negative (suctional) 

pressure, which is further raised when there is increased 

upper airway resistance (adenoidal hypertrophy, tonsil-

lar hypertrophy, rhinitis) predisposing to airway collapse. 

The latter is prevented and airway patency is ensured by 

the combined muscular tone of genioglossus, geniohyoid, 

sternohyoid, sternothyroid and thyroid muscle 17-19 . 

However, this muscular tone is attenuated during sleep 

(especially in REM stage) and negative inspiratory pressure 

may lead to complete or partial collapse, resulting in 

airflow reduction or cessation (obstructive hypopnea or 

apnea, respectively). 

It is common knowledge that prevalence of OSAS is 

highest in the ages between 2-8 years old, as the development 

of pharyngeal lymphatic tissue causes maximum 

narrowing of airway lumen 20 . Brain MRI sagittal planes 

from 189 children and adults without clinical evidence 

of adenoid hypertrophy revealed that pharyngeal tonsill 

reaches its maximum size between 7-10 years old and 

minimum size at the age of 60 21 . Adenoid size and airway 

lumen were not correlated in that study. In a second 

study, MRI from children who did not snore showed that 

increase of pharyngeal lymphatic volume is symmetrical 

to upper airway diameter 22 . Therefore, palatine and pharyngeal 

tonsillar hypertrophy is considered pathologic in 

subgroups of children and associated with OSAS 23-25 . 

Despite recent advancements in the study of pharyngeal 

lymphatic tissue development during the first years 

of age, few studies have been published so far. Moreover, 

none of these studies has described alterations in tonsillar 

and adenoid volume during childhood with CT or MRI in 

patients with obstructive sleep apnea. Therefore, the acknowledgement 

that pharyngeal lymphatic tissue reaches 

its maximum volume in children who snore between 2-8 

years old is mostly empirical. 

Pathogenesis of OSAS and Obesity 

Obesity is a well- known significant risk factor for 

obstructive sleep apnea in adults, despite lack of a distinct 

pathogenetic mechanism. On the contrary, the correlation 

between body mass index and apnea-hypopnea 

index varies from extremely strong to weak in pediatric 

literature 26-29 . 

A study in Greek children demonstrates that, in ages 

under 6 years old, the risk of developing OSAS is similar 

among obese or overweight children and children with 

normal body weight 30 . A probable explanation for this observation 

is that upper airway occlusion is mostly caused 

by adenotonsillar hypertrophy in this age. However, older 

obese or overweight children appear to be at greater risk. 

Data from a prospective study in Cleveland clearly supports 

that between 13-16 years old, obese or overweight 

teenagers are at greater risk of developing obstructive 

sleep apnea compared to normal weighed teenagers 31 . 

Diagnosis 

Current diagnostic methods aim at detecting patients 

with obstructive breathing disorders who are at risk of 

developing complications. History and physical examination, 

pulse oximetry, daytime polysomnopraphic study, 

unattended limited sleep study and full polysomnography 

TSARA V 

have been adequately evaluated. 

History and physical examination are unable to distinguish 

between children with OSAS and primary snoring; 

however they are useful in selection of those who 

should be screened for OSAS in a sleep centre 32,33 . A reliable 

evaluation tool is pulse oximetry, as positive results 

are predictive of pathologic polysomnographic findings. 

It should be noted that negative results cannott rule out 

the possibility of a pathologic sleep study 34,35 . 

Daytime polysomnographic study has an acceptable 

predictive value and pathologic findings should lead to 

initiation of treatment of OSAS without requiring a second 

nocturnal polysomnography. Nevertheless, negative 

results should be confirmed by nocturnal polysomnographic 

study 36,37 . Limited polysomnography at home 

is cost-effective compared to in-laboratory study but it 

underestimates the number of obstructive hypopneas and 

overestimates the number of central apneas 38 . Current 

data is insufficient to allow application of this method in 

clinical practice. 

Full night polysomnography is the only diagnostic 

method able to quantify sleep related breathing disorders 

and is considered the gold standard for the diagnosing of 

OSAS. It can be easily performed at any age, provided 

appropriate equipment and trained health care providers 

are available. The following parameters are recorded during 

polysomnography: respiratory movements, oronasal 

airflow, hemoglobin oxygen saturation, end-expiratory 

CO 2 , electrocardiogram, electroencephalogram, electrooculogram, 

chin and tibial electromyogram. Combined 

analysis of these parameters can lead to an accurate diagnosis. 

Complications of OSAS 

Since the original recognition and description of 

OSAS in children, it has become evident that it is associated 

with serious complications such as growth delay, 

pulmonary hypertension and cor pulmonale 1 . In the recent 

years, growth delay is rarely reported owing to early 

diagnosis of breathing disorder. One interesting observation 

is that growth rate is improved after adenotonsillectomy 

even in obese children 39 . It seems that one major 

factor responsible for postoperative weight gain is reduction 

in respiratory effort. 

Higher blood pressure levels have been reported in 

children with OSAS and they seem to persist in wakefullness 

40,41 . Children with primary snoring who are referred 

to sleep centers have higher blood pressure compared to 

normal children 43 ; however history of snoring is not considered 

a risk factor for high blood pressure in the general 

pediatric population 43 . 

Several case reports of children with severe OSAS 

have been described, who developed right heart failure 

(cor pulmonale) probably due to episodes of nocturnal 

hypoxemia and resulting pulmonary vasoconstriction 44,45 . 

Other studies detected reduction in right ventricular flow 

volume and increase in left ventricular mass with radioisotope 

ventriculography and ultrasonography 46,47 .

Recent data support that obstructive sleep disorders in 

childhood are associated with alterations predisposing to 

cardiovascular disease in adulthood. OSAS in childhood 

has been related to chronic inflammation (higher levels 

of C-reactive protein) 48,49 , metabolic disorders (higher 

levels of insulin, cholesterol, triglycerides) 50 , vascular 51,52 

and myocardial alterations 53 . Until recently development 

of right ventricular hypertrophy was considered of great 

importance, whereas currently a positive correlation between 

left ventricular mass and apnea-hypopnea index 

has been recognized 53 . 

Another possible complication of OSAS in children 

is increased prevalence of neurodevelopmental disorders 

such as learning difficulties and low school performance, 

behavioral disorders, attention deficit syndrome, daytime 

sleepiness and hyperactivity 54,55 . It is indicated that children 

with primary snoring are also at risk of developmental 

and behavioral disorders 56 . It is unknown whether these 

disorders are fully reversible after treatment initiation. 

Treatment 

Diagnosis of OSAS in childhood is established with 

polysomnographic study in a sleep center. Selection of 

the appropriate therapeutic intervention is based on apnea 

hypopnea index (AHI), which corresponds to the number 

of obstructive and mixed apneas and hypopneas per hour 

of sleep 57 . Performing sleep studies in all children who 

snore is considered impossible even in countries with a 

costly health system and development of screening criteria 

is required for the detection of patients at high risk of 

having sleep apnea and associated morbidity. 

The treatment of choice for management of moderate-to-severe 

OSAS (AHI > 5/hour) in children with adenoid 

and/ or tonsillar hypertrophy is combined adenotonsillectomy 

58 . Polysomnographic data shows remission of 

clinical symptoms and improved findings. Many children 

with OSAS have been improved and the efficacy of the 

method has been correlated to preoperative assessment of 

the severity 59 . Obesity is a predictive factor of poor outcome 

60 . However, recent studies demonstrate that postoperatively 

even obese children experience significant 

improvement of intermittent airway obstruction during 

sleep 61 , as well as reduction in cholesterol and triglyceride 

levels 62 . 

Regional nasal corticosteroids have been administered 

to children with mild OSAS established by polysomnography 

(AHI 1-5/hour) who do not meet the criteria for 

surgical management but experience severe breathing 

symptoms during sleep 63,64 . Administration of regional 

nasal corticosteroids for a period of 4-6 weeks improves 

symptoms and polysomnographic findings and this benefit 

has been attributed to reduction of adenoid size and to 

remission of chronic inflammation in nasal mucosa 65 . 

Use of positive nasal pressure is indicated in children 

with persistent symptoms and polysomnographic findings 

of obstructive apnea, despite tonsillectomy/adenoidectomy 

and administration of nasal corticosteroids 58 . It is 

also indicated in children with body mass index compat- 


ible with obesity who do not respond to other therapeutic 

methods as well as children with neuromuscular deficits 

and craniofacial disorders 66 . The level of AHI beyond 

which positive nasal pressure is suggested has not been 

determined in children, but morbidity due to the disorder 

seems to increase in AHI > 5/hour 67 . 

Conclusions 

Snoring in children is not always benign and can be 

associated with serious complications. 

All children should be screened for snoring during 

regular medical visits and those who are found positive 

should be referred for further investigation. 

Early diagnosis and management of OSAS improves 

quality of life and probably prevents possible complications. 

Pharyngeal and palatine tonsillar hypertrophy and 

obesity are the most common causes of the syndrome. 

DIAGNOSTIC CRITERIA 

Diagnosis of OSAS in children cannot be established 

upon history of snoring and physical examination. 

Determination of the presence and severity of 

OSAS requires a polysomnographic study. However, 

it is extremely difficult, if not impossible, to perform 

sleep studies to the large number of children who experience 

frequent snoring (about 10% of childhood 

population). Therefore, the clinical physician should be 

able to identify a child who is at high risk of having 

moderate-to-severe OSAS by the presence of a number 

of symptoms indicating upper airway obstruction during 

sleep or signs of associated morbidity (apnea related 

clinical or laboratory findings). 

The next section presents a simple classification of 

these diagnostic criteria. It should be noted that the following 

criteria were developed for children with pharyngeal 

lymphatic hypertrophy and/or obesity as the 

primary cause of apnea. Children with neuromuscular 

disease, genetic deformities or craniofacial defects comprise 

a different group of patients that should be evaluated 

by specialized physicians. 

CLINICAL PRESENTATION 

The following parameters from patient history, physical 

examination and laboratory tests have not been comparatively 

evaluated for their contribution to the diagnosis 

of OSAS. Therefore, they are mentioned in random 

order. 

PATIENT HISTORY 

Main nocturnal symptoms: Loud and constant snoring, 

apnoic events witnessed by parents, unrefreshing 

sleep sleep, frequent arousals, increased respiratory effort 

during sleep, cervical stretch during sleep. 

Main daytime symptoms: Oral respiration, difficulty 

in waking up, morning headaches. 

Signs of apnea related morbidity: Daytime sleepiness, 

hyperactivity, behavioral disorders (e.g. aggressive-

ness, bad manners), lack of concentration and attention, 

low school performance, nocturnal enuresis. 

PHYSICAL EXAMINATION 

General assessment: Body weight measurement and 

calculation of body mass index (BMI), blood pressure 

measurement 

Nose examination for: Nasal diaphragm scoliosis, 

nasal mucosa thickness, nasal polypodes, signs compatible 

with allergic rhinitis. 

Rhinopharynx assessment for: Adenoid tonsills, 

choanal atresia, space- occupying abnormalities. 

Oropharynx assessment for: Tongue size, uvula 

morphology and size (bifid uvula), soft palate morphology 

(e.g. short, long), tonsillar volume and position (classification 

by Mallampati). 

Facial profile: Orthognathic, convex, cavernous. 

Lips at rest: In contact, not in contact. 

LABORATORY TESTS 

C- reactive protein (CRP), total cholesterol, LDL 

cholesterol, HDL cholesterol, Triglycerides. 

The subgroups of patients who should undertake this 

assessment have not been determined in current literature. 

Suggested management 

Children with neuromuscular disorders, genetic 

syndromes and craniofacial disfigures: They are a special 

population group frequently with a complex pathophysiology. 

They should be referred to a group of specialists 

in the management of such conditions. 

Children with adenotonsillar hypertrophy who experience: 

Nocturnal and daytime symptoms compatible with 

OSAS, signs of apnea related morbidity, or laboratory 

findings of apnea related disorder, are highly probable 

to report improvement after adenoidectomy and tonsillectomy. 

Sleep study in children with severe signs and symptoms 

can lead to preoperative detection of those who are 

at higher risk of developing postoperative complications 

or recessive disease. 

Children with adenoid and palatine tonsillar hypertrophy 

and mild clinical presentation (e.g. without 

laboratory disorders or associated morbidity): The 

necessity of adenotonsillectomy depends on the physician. 

However, polysomnographic estimation of AHI > 

5/hour indicates surgical management. 

Nocturnal hypoxemia is an alternative method provided 

there is no available sleep center. 

Nasal corticosteroid administration for 4-6 weeks can 

limit the severity of obstructive sleep disorder in those 

children. 

Obese children with adenoid and/or tonsillar hypertrophy: 

Surgical management is indicated, as in normal 

weighed children. Concomitant weight control is a 

TSARA V 

significant complementary treatment target. 

Obese children without pharyngeal/ palatine tonsillar 

hypertrophy: Weight control and possibly use of 

positive nasal pressure is indicated. 

Children with recessive disease (persisting episodes 

of apnea- hypopnea postoperatively) are managed 

with: 

a. Nasal corticosteroid administration (provided there 

is nasal congestion) 

b. Body weight control (in obese children) 

c. Use of positive nasal pressure if AHI> 5-10 events/ 

hour (especially in obese patients, with neuromuscular 

diseases or craniofacial disfigures) 

Summarizing indications of sleep study 

1. In children when necessity of surgical management 

is questionable. 

2. In children with very severe symptoms and significant 

upper airway obstruction in physical examination, in 

order to detect the subgroup of patients at higher risk of 

developing operative and postoperative complications as 

well as recessive disease. 

3. Assessment of further management in this subgroup 

with a second sleep study. 

References 

1. Brouillette RT, Fernbach SK, Hunt CE. Obstructive sleep apnea 

in infants and children. J Pediatr. 1982; 100: 31-40. 

2. Ferreira AM, Clemente V, Gozal D, et al. Snoring in Portuguese 

primary school children. Pediatrics. 2000; 106: E64. 

3. Brunetti L, Rana S, Lospalluti ML, et al. Prevalence of obstructive 

sleep apnea syndrome in a cohort of 1,207 children of southern 

Italy. Chest. 2001; 120: 1930-1935. 

4. Lu LR, Peat JK, Sullivan CE. Snoring in preschool children: 

prevalence and association with nocturnal cough and asthma. 

Chest. 2003; 124: 587-593. 

5. Castronovo V, Zucconi M, Nosetti L, et al. Prevalence of habitual 

snoring and sleep-disordered breathing in preschoolaged 

children in an Italian community. J Pediatr. 2003; 142: 

377-382. 

6. Rosen CL, Larkin EK, Kirchner HL, et al. Prevalence and risk 

factors for sleep-disordered breathing in 8- to 11-year-old children: 

association with race and prematurity. J Pediatr. 2003; 142: 

383-389. 

7. Kaditis AG, Finder J, Alexopoulos EI, et al. Sleep-disordered 

breathing in 3,680 Greek children. Pediatr Pulmonol. 2004; 37: 

499-509. 

8. Carroll JL, McColley SA, Marcus CL, Curtis S, Loughlin GM. 

Inability of clinical history to distinguish primary snoring from 

obstructive sleep apnea syndrome in children. Chest. 1995; 108: 

610-618. 

9. Leach J, Olson J, Hermann J, Manning S. Polysomnographic 

and clinical findings in children with obstructive sleep apnea. 

Arch Otolaryngol Head Neck Surg. 1992; 118: 741-744. 

10. Wang RC, Elkins TP, Keech D, Wauquier A, Hubbard D. Accuracy 

of clinical evaluation in pediatric obstructive sleep apnea. 

Otolaryngol Head Neck Surg. 1998; 118: 69-73. 

11. Ferber R, Kryger M. Principles and Practice of Sleep Medicine 

in the child. Harvard University, Boston, Massachusetts: W.B. 

Saunders Company, 1995. 

12. Brouillette R, Hanson D, David R, Klemka L, Szatkowski A, 

Fernbach S. A diagnostic approach to suspected obstructive 

sleep apnea in children. J Pediatr. 1984; 105: 10-14.

13. Stradling JR, Thomas G, Warley AR, Williams P, Freeland A. 

Effect of adenotonsillectomy on nocturnal hypoxaemia, sleep 

disturbance, and symptoms in snoring children. Lancet. 1990; 

335: 249-253. 

14. Frank Y, Kravath RE, Pollak CP, Weitzman ED. Obstructive 

sleep apnea and its therapy: clinical and polysomnographic 

manifestations. Pediatrics. 1983; 71: 737-742. 

15. Guilleminault C, Korobkin R, Winkle R. A review of 50 children 

with obstructive sleep apnea syndrome. Lung 1981; 159: 

275-287. 

16. Potsic WP, Pasquariello PS, Baranak CC, Marsh RR, Miller LM. 

Relief of upper airway obstruction by adenotonsillectomy. Otolaryngol 

Head Neck Surg. 1986; 94: 476-480. 

17. Guilleminault C, Winkle R, Korobkin R, Simmons B. Children 

and nocturnal snoring: evaluation of the effects of sleep related 

respiratory resistive load and daytime functioning. Eur J Pediatr. 

1982; 139: 165-171. 

18. Richardson MA, Seid AB, Cotton RT, Benton C, Kramer M. 

Evaluation of tonsils and adenoids in Sleep Apnea syndrome. 

Laryngoscope. 1980; 90: 1106-1110. 

19. Remmers JE, deGroot WJ, Sauerland EK, Anch AM. Pathogenesis 

of upper airway occlusion during sleep. J Appl Physiol. 

1978; 44: 931-938. 

20. Jeans WD, Fernando DC, Maw AR, Leighton BC. A longitudinal 

study of the growth of the nasopharynx and its contents in 

normal children. Br J Radiol. 1981; 54: 117-121. 

21. Vogler RC, Ii FJ, Pilgram TK. Age-specific size of the normal 

adenoid pad on magnetic resonance imaging. Clin Otolaryngol. 

Allied Sci 2000; 25: 392-395. 

22. Arens R, McDonough JM, Corbin AM, et al. Linear dimensions 

of the upper airway structure during development: assessment 

by magnetic resonance imaging. Am J Respir Crit Care Med. 

2002; 165: 117-122. 

23. Fregosi RF, Quan SF, Kaemingk KL, et al. Sleep-disordered 

breathing, pharyngeal size and soft tissue anatomy in children. J 

Appl Physiol. 2003; 95: 2030-2038. 

24. Arens R, McDonough JM, Corbin AM, et al. Upper airway 

size analysis by magnetic resonance imaging of children with 

obstructive sleep apnea syndrome. Am J Respir Crit Care Med. 

2003; 167: 65-70. 

25. Arens R, McDonough JM, Costarino AT, et al. Magnetic resonance 

imaging of the upper airway structure of children with 

obstructive sleep apnea syndrome. Am J Respir Crit Care Med. 

2001; 164: 698-703. 

26. Redline S, Tishler PV, Schluchter M, Aylor J, Clark K, Graham 

G. Risk factors for sleep-disordered breathing in children. Associations 

with obesity, race, and respiratory problems. Am J 

Respir Crit Care Med. 1999; 159: 1527-1532. 

27. Wing YK, Hui SH, Pak WM, et al. A controlled study of sleep 

related disordered breathing in obese children. Arch Dis Child. 

2003; 88: 1043-1047. 

28. Lam YY, Chan EY, Ng DK, et al. The correlation among obesity, 

apnea-hypopnea index, and tonsil size in children. Chest. 2006; 

130: 1751-1756. 

29. Mameli E, Petrou V, Hatziathanasiou C, Hatzis A, Radiotis A, 

Apostolopoulos N. Study of the obstructive sleep apnea syndrome 

in obese children. Greek Pediatric Society Congress. 

2008; EA 112. 

30. Kaditis AG, Alexopoulos EI, Hatzi F, et al. Adiposity in relation 

to age as predictor of severity of sleep apnea in children with 

snoring. Sleep Breath. 2008; 12: 25-31. 

31. Ievers-Landis CE, Redline S. Pediatric sleep apnea: implications 

of the epidemic of childhood overweight. Am J Respir Crit Care 

Med. 2007; 175: 436-441. 

32. Schechter MS. Technical report: diagnosis and management of 

childhood obstructive sleep apnea syndrome. Pediatrics. 2002; 

109: e69. 

33. Urschitz MS, Wolff J, Von Einem V, Urschitz-Duprat PM, 

Schlaud M, Poets CF. Reference values for nocturnal home 


pulse oximetry during sleep in primary school children. Chest. 

2003; 123: 96-101. 

34. Mead J, Peterson N, Grimby G. Pulmonary ventilation measured 

from body surface movements. Science. 1967; 156: 1383-1384. 

35. Sharp JT, Druz WS, Foster JR, Wicks MS, Chokroverty S. Use 

of the respiratory magnetometer in diagnosis and classification 

of sleep apnea. Chest. 1980; 77: 350-353. 

36. Strollo PJ, Jr., Sanders MH. Significance and treatment of nonapneic 

snoring. Sleep. 1993; 16: 403-408. 

37. Guilleminault C, Stoohs R, Clerk A, Cetel M, Maistros P. A 

cause of excessive daytime sleepiness. The upper airway resistance 

syndrome. Chest. 1993; 104: 781-787. 

38. American Thoracic Society. Standards and indications for cardiopulmonary 

sleep studies in children. Am J Respir Crit Care 

Med. 1996; 153: 866-878. 

39. Marcus CL, Carroll JL, Koerner CB, Hamer A, Lutz J, Loughlin 

GM. Determinants of growth in children with the obstructive 

sleep apnea syndrome. J Pediatr. 1994; 125: 556-562. 

40. Marcus CL, Greene MG, Carroll JL. Blood pressure in children 

with obstructive sleep apnea. Am J Respir Crit Care Med. 1998; 

157: 1098-1103. 

41. Enright PL, Goodwin JL, Sherrill DL, Quan JR, Quan SF. Blood 

pressure elevation associated with sleep-related breathing disorder 

in a community sample of white and Hispanic children: 

the Tucson Children’s Assessment of Sleep Apnea study. Arch 

Pediatr Adolesc Med. 2003; 157: 901-904. 

42. Kwok KL, Ng DK, Cheung YF. BP and arterial distensibility in 

children with primary snoring. Chest. 2003; 123: 1561-1566. 

43. Kaditis AG, Alexopoulos EI, Kostadima E, et al. Comparison 

of blood pressure measurements in children with and without 

habitual snoring. Pediatr Pulmonol. 2005; 39: 408-414. 

44. Hunt CE, Brouillette RT. Abnormalities of breathing control and 

airway maintenance in infants and children as a cause of cor pulmonale. 

Pediatr Cardiol. 1982; 3: 249-256. 

45. Steier M, Shapiro SC. Cor pulmonale from airway obstruction in 

children. JAMA. 1973; 225: 67. 

46. Tal A, Leiberman A, Margulis G, Sofer S. Ventricular dysfunction 

in children with obstructive sleep apnea: radionuclide assessment. 

Pediatr Pulmonol. 1988; 4: 139-143. 

47. Sofer S, Weinhouse E, Tal A, et al. Cor pulmonale due to adenoidal 

or tonsillar hypertrophy or both in children. Noninvasive 

diagnosis and follow-up. Chest. 1988; 93: 119-122. 

48. Gozal D, Lipton AJ, Jones KL. Circulating vascular endothelial 

growth factor levels in patients with obstructive sleep apnea. 

Sleep. 2002; 25: 59-65. 

49. Tauman R, Ivanenko A, O’Brien LM, Gozal D. Plasma C-reactive 

protein levels among children with sleep-disordered breathing. 

Pediatrics. 2004; 113: e564-569. 

50. de la Eva RC, Baur LA, Donaghue KC, Waters KA. Metabolic 

correlates with obstructive sleep apnea in obese subjects. J Pediatr. 

2002; 140: 654-659. 

51. Amin RS, Carroll JL, Jeffries JL, et al. Twenty-four-hour portable 

blood pressure in children with sleep-disordered breathing. 

Am J Respir Crit Care Med. 2004; 169: 950-956. 

52. Amin R, Kimball T, Urbina E, et al. Carotid artery structure and 

stiffness in children with obstructive sleep apnea. Proc Am Thorac 

Soc. 2005; 5: A528. 

53. Amin RS, Kimball TR, Bean JA, et al. Left ventricular hypertrophy 

and abnormal ventricular geometry in children and adolescents 

with obstructive sleep apnea. Am J Respir Crit Care Med. 

2002; 165: 1395-1399. 

54. Gozal D, Pope DW, Jr. Snoring during early childhood and academic 

performance at ages thirteen to fourteen years. Pediatrics. 

2001; 107: 1394-1399. 

55. O’Brien LM, Holbrook CR, Mervis CB, et al. Sleep and neurobehavioral 

characteristics of 5- to 7-year-old children with 

parentally reported symptoms of attention-deficit/hyperactivity 

disorder. Pediatrics. 2003; 111: 554-563. 

56. O’Brien LM, Mervis CB, Holbrook CR, et al. Neurobehavioral

implications of habitual snoring in children. Pediatrics. 2004; 

114: 44-49. 

57. American Academy of Pediatrics. Clinical practice guideline: 

diagnosis and management of childhood obstructive sleep apnea 

syndrome. Pediatrics. 2002; 109: 704-712. 

58. Lipton AJ, Gozal D. Treatment of obstructive sleep apnea in 

children: do we really know how? Sleep Med Rev. 2003; 7: 

61-80. 

59. Suen JS, Arnold JE, Brooks LJ. Adenotonsillectomy for treatment 

of obstructive sleep apnea in children. Arch Otolaryngol 

Head Neck Surg. 1995; 121: 525-530. 

60. O’Brien L M, Sitha S, Baur LA, Waters KA. Obesity increases 

the risk for persisting obstructive sleep apnea after treatment in 

children. Int J Pediatr Otorhinolaryngol. 2006; 70: 1555-1560. 

61. Mitchell RB, Kelly J. Outcome of adenotonsillectomy for obstructive 

sleep apnea in obese and normal-weight children. Otolaryngol 

Head Neck Surg. 2007; 137: 43-48. 

62. Gozal D, Sans Capdevila O, Kheirandish-Gozal L. Metabolic 

Alterations in Obstructive Sleep Apnea among Non-Obese and 

Obese Prepubertal Children. Am J Respir Crit Care Med. 2008; 

doi: 10.1164/rccm. 200711-1670OC. 

63. Brouillette RT, Manoukian JJ, Ducharme FM, et al. Efficacy of 

fluticasone nasal spray for pediatric obstructive sleep apnea. J 

TSARA V 

Pediatr. 2001; 138: 838-844. 

64. Alexopoulos EI, Kaditis AG, Kalampouka E, et al. Nasal corticosteroids 

for children with snoring. Pediatr Pulmonol. 2004; 

38: 161-167. 

65. Goldbart AD, Veling MC, Goldman JL, Li RC, Brittian KR, 

Gozal D. Glucocorticoid receptor subunit expression in adenotonsillar 

tissue of children with obstructive sleep apnea. Pediatr 

Res. 2005; 57: 232-236. 

66. Capdevila OS, Kheirandish-Gozal L, Dayyat E, Gozal D. Pediatric 

Obstructive Sleep Apnea: Complications, Management, and 

Long-term Outcomes. Proc Am Thorac Soc. 2008; 5: 274-282. 

67. Larkin EK, Rosen CL, Kirchner HL, et al. Variation of C-reactive 

protein levels in adolescents: association with sleep-disordered 

breathing and sleep duration. Circulation. 2005; 111: 

1978-1984. 

Conflict of interest: none 

Acknowlegmend 

The EC of HSSD would like to thank Professor D. 

Bouros for his considerable contribution to the development 

of the guidelines.

HIPPOKRATIA 2010, 14, 1: 63 


LETTER 

Immunomodulation by alpha-fetoprotein in neurological disorders may involve 

oncogenic dilemmas 

Kountouras J, Zavos Ch, Deretzi G, Giartza-Taxidou E, Gavalas E, Chatzigeorgiou S 

2 nd Dpt Internal Medicine, Aristotle University of Thessaloniki, Hippokratio Hospital, Thessaloniki, Greece 

Key words: alpha-fetoprotein, autoimmune disorders, tumorigenesis, Helicobacter pylori 

Conflict of interest: None declared 

Corresponding author: Jannis Kountouras, 8 Fanariou St, Byzantio, 551 33, Thessaloniki, Central Macedonia, Greece, Tel: +30-2310-892238, 

FAX: +30-2310-992794, E-mail: jannis@med.auth.gr 

Dear Editor: 

Recent data provide new roles for alpha-fetoprotein (AFP) 

in controlling the autoimmune inflammation associated 

with experimental autoimmune encephalomyelitis 

(EAE), thereby suggesting a therapeutic potential for 

recombinant AFP in EAE and other relative autoimmune 

disorders such as multiple sclerosis (MS) or rheumatoid 

arthritis 1 . Although this suggestion might be correct, it 

possibly reflects only one side of the coin. Had AFP role 

been pro-apoptotic in effector immune cells, this would 

also result in a protection against cancer development, 

because prolonged immune responses of such effector cells 

that exhibit defective apoptosis have been associated with 

chronic epithelial damage, predisposing for tumorigenesis 

in many tissues; resistance of T-cells to apoptotic death 

can extend their lifespan and result in an exceedingly 

prolonged immune response leading to perpetuation 

of chronic inflammation with potential tumorigenic 

effect. For instance, in upper gastrointestinal tract chronic 

inflammation has been linked to gastric cancer associated 

with Helicobacter pylori (H. pylori) infection 2 . However, 

AFP-positive gastric cancer has an aggressive behavior; 

it is strongly associated with hematogenous conditions 

such as venous invasion, hepatic and brain metastases 

and aggressive biological factors (p53 abnormalities) 3 

Mutations of the p53 gene may be an early event and 

perhaps work together with H. pylori infection in the 

pathogenesis of gastric cancer. Mutations of the p53 gene 

have been thought to upregulate vascular endothelial 

growth factor (VEGF) and possibly the inducible nitric 

oxide synthase (iNOS) 2 In this regard, higher expression 

of VEGF isoform C might be an explanation for the 

poorer prognosis of AFP-producing gastric cancers 4 

Moreover, apart from p53 mutations, H. pylori infection 

also induces upregulation of VEGF and iNOS expression 

and subsequent DNA damage as well as enhanced antiapoptosis 

signal transduction, thereby contributing to 

gastric carcinogenesis 2 Taken together, these data suggest 

that AFP-associated abnormalities of p53 are essential in 

the early pathogenesis particularly of H. pylori-related 

gastric cancer, and, moreover, they might be related with 

the tumor aggressiveness. Of note, loss of heterozygosity 

and mutations of the p53 also occur commonly in brain 

tumors 8,9 . 

Importantly, H. pylori may activate the c-Met, 

thereby promoting gastric cancer. A higher frequency of 

c-Met expression is observed in AFP-producing gastric 

cancer and is associated with decreased apoptosis, high 

incidence of liver metastases and poor prognosis 2,4 . 

A higher expression of c-Met might be one further 

explanation for the poorer prognosis of AFP-producing 

gastric cancers. 

Our recent series reported a relationship between 

MS and H. pylori infection 5 involved in the mentioned 

carcinogenesis and aggressiveness of upper gastrointestinal 

malignancies through various mechanisms including 

indirect associations with AFP. Therefore, further relative 

studies are warranted, before the therapeutic introduction of 

the potentially oncogenic recombinant AFP in autoimmune 

diseases including neurological disorders. 

References 

1. Irony-Tur-Sinai M, Grigoriadis N, Tsiantoulas D, Touloumi O, 

Abramsky O, Brenner T. Immunomodulation of EAE by alphafetoprotein 

involves elevation of immune cell apoptosis markers 

and the transcription factor FoxP3. J Neurol Sci 2009; 279: 80- 

87. 

2. Kountouras J, Zavos C, Chatzopoulos D, Katsinelos P. New 

aspects of Helicobacter pylori infection involvement in gastric 

oncogenesis. J Surg Res 2008; 146: 149-158. 

3 Ishigami S, Natsugoe S, Nakashima H, Tokuda K, Nakajo A, 

Okumura H, et al. Biological aggressiveness of alpha-fetoprotein 

(AFP)-positive gastric cancer. Hepatogastroenterology 2006; 53: 

338-341. 

4 Kountouras J, Zavos C, Chatzopoulos D, Katsinelos P. Molecular 

mechanisms associated with aggressiveness of alpha-fetoproteinpositive 

gastric cancer. Hepatogastroenterology 2007; 54: 329- 

330. 

5 Gavalas E, Kountouras J, Deretzi G, Boziki M, Grigoriadis N, 

Zavos C, et al. Helicobacter pylori and multiple sclerosis. J 

Neuroimmunol 2007; 188: 187-189.

Hippokratia will consider for publication: 

1. Editorial and invited articles. 

2. Review articles. These should be written by experts on the 

subject. The subject of the review should be treated in a chronological 

order of its developments and emphasis should be placed on the 

most recent ones. They must include an abstract language, which 

should be less than 300 words long. 

The article should be no more than 6 printed pages long. After 

the 6 th page, each printed page costs 150 Euro. 

3. Original articles. These should be of experimental, clinical or 

epidemiologcal character. 

It should include: a structured abstract language, introduction, 

in which the recent developments on the subject of the research and 

the reason for the undertaken study should be reported; description 

of the Material and Methods; report of the Results; and Discussion, 

which should include the conclusions of the study. The article 

should be no more than 5 printed pages long. After the 5 th page, each 

printed page costs 150 Euro. 

4. Case Reports. Rare clinical cases with interesting presentation, 

diagnosis or treatment should be described in them. They 

should include Abstract, short Introduction, Description of case, and 

short Discussion. They should be less than 3 printed pages long. The 

first and the second page are free. The third page costs 150 euro. 

5. Letters to the Editor should be concise and less than one 

printed page long. 

6. The editorial board of the journal has the right to publish the 

abstracts of Congresses, Seminars etc. 

Manuscript preparation: Articles submitted for publication 

should be written in English language. The copy-editor of the journal 

has the right to change the language structure of the manuscript 

without transforming its meaning by the author. 

Number pages consecutively in this order: title page, abstract, 

text, references, legends, and tables. Figures should be provided 

separately. 

a. On the title page provide the title of the article, list each 

author’s name and institutional affiliation, and indicate the corresponding 

author. In case, the study has been reported in abstract 

form elsewhere, indicate the respective scientific meeting. 

b. On the abstract page provide the abstract (background, 

methods, results, conclusions) and 3-7 key-words. 

c. Figure and Table preparation. 

Figures: For reproduction in the journal you will be required, 

to supply high resolution .tiff images in separate files (1200 dpi for 

line drawings and 300 dpi for color and half tone work at intended 

display size – column width of 76 mm or page width of 160 mm) or 

high quality printouts on glossy paper. It is advisable to create your 

high resolution images first as they can easily converted into low 

resolution images for on line submission. Line drawings, graphs, 

and charts should be professionally drawn or computer generated 

and printed on a high resolution laser printer. Any lettering in the 

figures should be large enough to stand photographic reduction. Authors 

should prepare their figures for either one column (76 mm) 

or the entire page width (160 mm). The editors reserve the right to 

reduce the size of illustrated material. Authors may, however, specifically 

request a larger reproduction. 

Figures should be numbered consecutively with Arabic numerals, 

in the order in which they appear in the text. Reference should 

be made in the text to each figure. Each figure must be accompanied 

by an explanatory legend, typewritten with double spacing and the 

legends to all figures should be typed together on a separate sheet at 

the end of the manuscript. 

Any photomicrographs, electron micrographs or radiographs 

must be of high quality. Photomicrographs of histopathological 

specimens should provide details of staining technique and magnification 

used (or use an internal scale bar). All micrographs must 

carry a magnification bar. Explain all symbols used in the figure. 

Patients shown in photographs should have their identity concealed 

or should have given their written consent to publication of the photographs. 

For a photograph of a minor, signed parental permission 

is required. 

Tables should be added at the end of the manuscript and not 

Instructions to authors 

interspersed throughout the manuscript. They should be submitted 

as part of the Word document, typed neatly, each table on a separate 

sheet in double spacing, with the title above and a clear legend 

below. The legend should contain all the necessary information so 

that the table and legend may stand alone, independent of the text. 

Explain all abbreviations. Standard abbreviations of units of measurement 

should be added between parentheses. A table must have 

at least two columns. Column headings should be brief, but sufficiently 

explanatory. Lists are to be incorporated into the text. Do 

not use patient initials in tables. Patients should be referred to by 

sequential Arabic numerals, not by their initials. 

d. References: Follow the Vancouver system omitting the 

month and issue number. 

The author is responsible for obtaining written permission to 

reproduce previously published material (illustrations, tables) from 

the copyright holder. The consent of the senior author must also be 

acquired. 

The submitted manuscript should be accompanied by a cover 

letter which should specify: 

1. a statement that the submission is not under consideration by 

any other journal or published previously (apart from abstracts); 

2. a statement by the responsible author certifying that all coauthors 

have seen and agree with the contents of the manuscript. 

These requirements are absolute. 

It is a policy of the journal that submissions are not returned 

back to the authors. Proofs of submissions accepted for publication 

are sent to the authors only for typographical editing. Proofs are 

accompanied by a document for ordering a specified number of reprints 

by the authors. 

Transfer of copyright to the journal “Hippokratia” is a condition 

of publication. 

The corresponding author must include a Conflict of Interest 

Statement on behalf of all authors at the end of the article. If there is 

no conflict of interest it must stated too. 

The manuscript can be submitted on line (www.hippokratia.gr), 

by e-mail (geover@otenet.gr or hippokratia@ippokratio.gr) or by 

ground mail. 

Submission by ground mail: Submit three high-quality copies 

of the manuscript. Type or print entire manuscript, including references, 

tables, and figure legends, double spaced on standard-sized, 

good quality white bond, using amble margins. 

The printed material must be accompanied by a disk: Storage 

Medium. 3-1/2” high density disk or CD in Windows. 

Software and format: Microsoft Word 6.0 or later is preferred. 

Refrain from complex formatting; the publisher will style the manuscript 

according to the Journal design specifications. Do not use 

desktop publishing software such as Aldus PageMaker, or Microsoft 

Publisher. If you prepared your manuscript with one of these 

programs, export the text to a word processing format. Please make 

sure your word processing program’s “fast save” feature is turned 

off. Please do not deliver files that contain hidden text: for example 

do not use your word processor’s automated features to create footnotes 

or reference files. 

File names. Submit the whole manuscript (abstracts, text, references, 

tables, legends) as a single file. Name each file with your last 

name (up to eight characters). Text files should be given the threeletter 

extension that identifies file format. 

Submit figures as separate files from text files, on the same or 

separate Vi” diskette or CD. Label all diskettes and CDs with the 

first Author’s name and a short title of the manuscript. 

Tables and charts should be adjuncts to the text and must not 

repeat material already presented. They should be numbered consecutively, 

with Roman numerals in the order in which they appear 

in the text. 

Labels: Label all disks with your name, the file name, and the 

word processing program and version used. 

Articles must be sent to: Georgios Vergoulas, Editor-in-Chief, 

Hippokratia, Hippokration General Hospital of Thessaloniki, 49, 

Kon. Karamanli Street, 546 42 Thessaloniki, Greece, Tel: +30 

2313312674, Fax: +30 2313312674, e-mail: hippokratia@ippokratio.gr 

or geover@otenet.gr

HIPPOKRATIA

Create successful ePaper yourself

Delete template?

Save as template?